Sequencing Primer, V2-F
USD 71.00
In Stock*
Size
-
- 1 nmol
Product Images

Specifications
Product Data | |
Sequence | 5' AGCAGAGCTCGTTTAGTGAACC 3' |
Applicable Vectors | PS100001, PS100002, PS100003, PS100004, PS100005, PS100006, PS100007, PS100008, PS100009, PS100010, PS100011, PS100012, PS100013, PS100014, PS100016, PS100017, PS100018, PS100020, PS100022, PS100024, PS100025, PS100026, PS100027, PS100034, PS100036, PS100038, PS100039, PS100040, PS100041, PS100042, PS100043, PS100044, PS100053, PS100054, PS100057, PS100058, PS100059, PS100064, PS100065, PS100066, PS100067, PS100069, PS100071, PS100074, PS100081, PS100082, PS100088, PS100092, PS100093, PS100094, PS100101, PS100102, PS100103, PS100104, PS100105, PS100107, PS100108, PS100109, PS100110, PS100111, PS100126, PS100135, PS100136, PS100139 |
Components | 1 vial of lyophilized sequencing primer (1 nmol, sufficient for 100 sequencing reactions) |
Quality Control | The primer has been tested to generate satisfactory sequencing data on ABI 3730. |
Storage | Store at -20°C. |
Stability | The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C |
Documents
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
Related Products (63)
pLenti-C-Myc-DDK-P2A-tGFP, Lenti vector with C-terminal Myc-DDK tag and tGFP after P2A peptide, 10ug
-
- 10 ug
pCMV6-AN-Myc-DDK-AC-His, mammalian expression vector with N-terminal Myc-DDK tags and C-terminal His tag, 10 ug
-
- 10 ug
pLenti-N-Myc-DDK-IRES-Puro, Lenti vector with N-terminal Myc-DDK tag and IRES-Puro, 10 ug
-
- 10 ug
pLenti-C-Myc-DDK-P2A-BSD, Lenti vector with C-terminal Myc-DDK tag and P2A-BSD, 10 ug
-
- 10 ug
pLenti-C-HA-DDK-P2A-Puro, Lenti vector with C-terminal HA-DDK tag and P2A-Puro, 10 ug
-
- 10 ug
pLenti-C-Myc-DDK-P2A-Puro, Lenti vector with C-terminal Myc-DDK tag and P2A-Puro, 10 ug
-
- 10 ug
Previous
Next
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.