OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCMV6-AN-His-HA Mammalian Expression Vector

Be the first to review this product
SKU
PS100017
pCMV6-AN-His-HA, mammalian vector with N-terminal HA-His tag, 10ug
  $670.00
In Stock*

Frequently Bought Together (3)

GE100111 Forward primer to sequence targets cloned in expression vectors.
1 nmol
$71.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00
Specifications
Specifications
Product Data
N-Tag His-HA
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Expression Promoter CMV
Features
  • ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the N-terminal HA-His tags.
  • Such clones are the best for detection and purification of the transgene expression using anti-HA or anti-His antibodies or a nickel affinity columns
  • If the N-terminal tagging interferes with the protein’s function, you can choose the C-terminal HA-His-tagging vector, PS100008
  • V2_F Primer can be used to sequence the target sequence after cloning.
  • XL39_R Primer can be used to sequence the target sequence after cloning.
Download Vector Sequence
Schematic of the multiple cloning sites
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Hyperconserved Elements in Human 5'UTRs Shape Essential Post-transcriptional Regulatory Networks
Zuccotti, Peroni, Potrich et al
Front Mol Biosci (2020) 7, 220 DOI: 10.3389/fmolb.2020.00220
Cited by 10
AI Summary: OriGene products, specifically the RBMX Myc-DDK Tagged ORF Clone (Cat# RC221307), were used in this study to overexpress RBMX and investigate its role as an RNA-binding protein regulating post-transcriptional networks via hyperconserved 5'UTR elements.
FigureFigureFigure
ASCs-Exosomes Recover Coupling Efficiency and Mitochondrial Membrane Potential in an in vitro Model of ALS
Calabria, Scambi, Bonafede et al
Front Neurosci (2019) 13, 1070 DOI: 10.3389/fnins.2019.01070
Cited by 84
AI Summary: OriGene contributed to this study by providing the human SOD1 (G93A) expression plasmid (OriGene, Cat# RC208601L4), which was used to generate the NSC-34(G93A) cell model for investigating mitochondrial dysfunction in ALS.
FigureFigureFigure
The Anti-Apoptotic Effect of ASC-Exosomes in an In Vitro ALS Model and Their Proteomic Analysis
Bonafede, Brandi, Manfredi et al
Cells (2019) 8 (9) DOI: 10.3390/cells8091087
AI Summary: In this study, the pCMV6-AN-His-HA plasmid (PS100017, OriGene) was used to construct a vector expressing the mutant hSOD1 gene, enabling the creation of an in vitro ALS model to investigate the neuroprotective effects of ASC-derived exosomes.
Snippet: The amplified fragment was digested with Sgf I and MluI enzymes and cloned into the pCMV6-AN-His-HA plasmid (PS100017, OriGene, Rockville, MD, USA) to give the vector pCMV6-HIS-HA-SOD1(G93A), expressing the mutant hSOD1 gene in fusion with an amino Cached
The hnRNP raly regulates PRMT1 expression and interacts with the ALS-linked protein FUS: implication for reciprocal cellular localization
Gasperini, Rossi, Cornella et al
Mol. Biol. Cell (2018)
AI Summary: OriGene products, specifically the pCMV6-Entry and pCMV6-HIS-HA-hFUS wt vectors, were used to generate expression constructs for c-MYC-tagged and HIS-HA-tagged human FUS protein, enabling the study of FUS interactions and localization in this research.
Snippet: polymerase (New England BioLabs) and then cloned in frame with either EGFP (pEGFP-N1, Clontech, in BglII and AgeI restriction sites), or c-MYC (pCMV6-Entry, Origene, in NheI (OriGene) to generate the vector pCMV6-HIS-HA-hFUS wt , expressing the hFUS gene
An homeotic post-transcriptional network controlled by the RNA-binding protein RBMX
Zuccotti, Peroni, Potrich et al
bioRxiv (2018)
Snippet: The amplified fragment was digested with 479 the SgfI and MluI restriction enzymes and cloned into the pCMV6-AN-His-HA plasmid 480 (PS100017, OriGene, Rockville, MD) to obtain the pCMV6-HIS-HA-RBMX vector, expressing 481 the gene fused with an amino-terminal polyhistidine (His) tag and a hemagglutinin (HA) epitope
HuD Is a Neural Translation Enhancer Acting on mTORC1-Responsive Genes and Counteracted by the Y3 Small Non-coding RNA
Tebaldi, Zuccotti, Peroni et al
Mol. Cell (2018) 71 (2), 256-270.e10 DOI: 10.1016/j.molcel.2018.06.032
AI Summary: OriGene contributed the pCMV6-AN-His-HA plasmid (catalog number PS100017), which was used as a recombinant DNA tool in the study to investigate the role of HuD in neural translation and mTORC1-responsive genes.
Snippet: GGTTATCAGAACTTATTAACATTAGTGTCACTAAAG TTGGTATACAACCCCCCACTGCTAAATTTGACTG GCTTTTT Köhn et al., 2015 N/A ------------------------- Recombinant DNA ------------------------- pCMV6-AN-His-HA Origene Catalog number PS100017 pCMV6-His-HA-HuD This study N/A pCMV6-His-HA-HuD (R248K) This study N/A pLenti CMV/TO His-HA-HuD This study N/A pGEM-T-Y3wt Köhn et al., 2015;... GGTTATCAGAACTTATTAACATTAGTGTCACTAAAG TTGGTATACAACCCCCCACTGCTAAATTTGACTG GCTTTTT Köhn et al., 2015 N/A ------------------------- Recombinant DNA ------------------------- pCMV6-AN-His-HA Origene Catalog number PS100017 pCMV6-His-HA-HuD This study N/A pCMV6-His-HA-HuD (R248K) This study N/A pLenti CMV/TO His-HA-HuD This study N/A pGEM-T-Y3wt Köhn et al., 2015
FigureFigureFigure
Showing 1-6 of 10 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products