Untagged Expression Vectors

OriGene offers genome wide untagged cDNA clones (TrueClones) for human, mouse and rat gene. All these untagged TrueClones are provided in one of a series pCMV6 expression vectors, which can be purchased separately as negative controls.

Vectors used for TrueClones:

  • pCMV6-XL4
  • pCMV6-XL5
  • pCMV6-XL6
  • pCMV6-Neo: Contains a Neo resistant marker for stable cell selection
  • pCMV6-AC: Contains a Neo resistant marker for stable cell selection
  • pCMV6-Entry: TrueClones in this vector contain the native stop codon before the C-terminal myc-DDK tag. Therefore, the C-terminal tag won't be expressed
Sequencing Primers (sold separately)
VP1.5 (forward) 5' GGACTTTCCAAAATGTCG 3'
XL39 (reverse) 5' ATTAGGACAAGGCTGGTGGG 3'
View Location on Vectors

Key Functional Features of pCMV6-XL4, XL5 & XL6 vectors:

  • Vector size: 4.7kb
  • Selection marker in E. coli: Ampicillin-resistance
  • Selection marker in mammalian cells: None. For transient transfection only
  • Promoter for in vivo expression in mammalian cells: CMV promoter
  • Promoter for in vitro cell free system: T7 (for pCMV6-XL4 and pCMV6-XL5) and SP6 for (pCMV6-XL6)
  • Cloning sites: EcoRI and SalI. While EcoRI is still preserved, SalI is destroyed upon cloning.
  • Restriction sites for removing insert: NotI. *Two NotI sites are flanking the cloning sites in the vector.
  • Cell line suitable for transfection: COS, 293, Hela, CHO, NIH3T3, Mouse L cell, etc.
  • Transcription termination and polyadenylation signals: from human growth hormone (hGH) gene.

images for pCMV6-XL4/5/6


Vector sequence

VectorMap

Extensive work has been done to engineer the vector to achieve high level of transgene expression level. When compared with another popular expression plasmid, pCDNA3.1 (Invitrogen), pCMV-based plasmids provide comparable if not higher level transgene expression.

Comparison of pCMV to pCDNA3

Fig 1. Comparison of transgene expression level in pCMV6- and pCDNA3.1-based plasmids. CAT gene was cloned downstream of the promoters in the pCMV6 and pCDNA3.1 vectors. In three independent experiments, a same quantity of plasmid DNA was transfected into COS1 cell and the CAT activity was scored.

References:
Cloning, structure and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem. 1989 May 15; 264(14): 8222-9. Andersson S, Davis DL, Dahlback H, Jornvall H, Russell DW.

Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation. J Biol Chem. 1989 Sep 25;264(27):16249-55. Andersson S, Bishop RW, Russell DW

Vector Resources