pCMV6-XL4 Mammalian Expression Vector

Snippet: AC-ZFAS1;CW303744), cDNA overexpressing constructs for ZNFX1(pCMV6-ZNFX1, cat no. RG214589), and vector control for pCMV6 (PS100001 or pCMV6-C-tGF: PS100010 or PCMV6XL4: 496,978) were purchased from OriGene Technologies, Inc.. Using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used for  transfection of plasmid constructs or antisense oligos (50 nM or 30 nM respectively);48–72h later, r

Snippet: ll Signaling Technology Inc., Beverly, MA, USA) was used as the secondary antibody. HEK293 cells (American Type Culture Collection, Manassas, VA, USA) transfected with TRPA1 plasmid DNA (pCMV6-XL4 by Origene, Rockville, MD, USA) were used as a positive control. HEK293 culturing and transfection were carried out as described previously [9, 12]. Immunoassay Lipocalin-2 (LCN2) and chemokine (C-X-C m

Snippet: S2840;Darolutamide, S7559), Cayman Chemical (RD162, 13039) and Sigma (E2, E2758, DHT, D073). Doxycycline was ordered from Takara (631311). Human AR full-length was cloned into the PCMV6-XL4 vector (Origene), pLVX-Puro vector (Takara Bio), and the Lenti-X Tet-One Inducible vector (Takara Bio). Human ESR1 was cloned into the PCMV6-XL4 vector and Lenti-X Tet-One Inducible vector. ESR1 shRNAs were c

Snippet: … First, we amplified the sequence comprising the signal peptide (SP, 1-29aa) and LAP of TGFβ1 prepropeptide (30-274aa, NM_000660.7) from the plasmid SPLAPTGFB1-pCMV6-XL4 (OriGene Technologies GmbH, Herford, Germany) by PCR using specific primers (Forward: AAGCTTATGCCGCCCTCCGGGCTGCGG and Reverse: GAATTCGCTTTGCAGATGCTGGGCCCTCTCCA) containing restriction sites for HindIII;To generate a latent form of cortistatin, we proceeded as follows. First, we amplified the sequence comprising the signal peptide (SP, 1-29aa) and LAP of TGFβ1 prepropeptide (30-274aa, NM_000660.7) from the plasmid SPLAPTGFB1-pCMV6-XL4 (OriGene Technologies GmbH, Herford, Germany) by PCR using specific primers (Forward: AAGCTTAT