OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCMV6-AN-Myc-DDK Mammalian Expression Vector

Be the first to review this product
SKU
PS100016
pCMV6-AN-Myc-DDK, mammalian vector with N-terminal Myc-DDK tag, 10ug
  $670.00
In Stock*

Frequently Bought Together (3)

GE100111 Forward primer to sequence targets cloned in expression vectors.
1 nmol
$71.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00
Specifications
Specifications
Product Data
N-Tag Myc-DDK
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Expression Promoter CMV
Features
  • ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the N-terminal Myc-DDK tags. (DDK is the same as FLAG® which is a registered trademark of Sigma Aldrich).
  • Such clones are the best for detection and purification of the transgene expression using anti-Myc or anti-DDK antibodies
  • If the N-terminal tagging interferes with the protein’s function, you can choose the C-terminal Myc-DDK-tagging vector, PS100007
  • V2_F Primer can be used to sequence the target sequence after cloning.
  • XL39_R Primer can be used to sequence the target sequence after cloning.
Download Vector Sequence
Schematic of the multiple cloning sites
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Dicer is cleaved by the Leader protease encoded by foot-and-mouth disease virus to promote infection in mammalian cells
Rodríguez-Pulido, Sanz, Camacho et al
Sci Adv (2025) 11 (27), eadt3751 DOI: 10.1126/sciadv.adt3751
Cited by 1
AI Summary: OriGene's pCMV6-AN-Myc-DDK (PS100016) plasmid was used as a vector for cloning and expressing proteins to study the cleavage of Dicer by the FMDV Leader protease in mammalian cells.
Snippet: TGGGAACCTGAGGTTGATT-3′), which introduced flanking Sgr I and Mlu I restriction sites (underlined). The PCR product was then digested with Sgr I and Mlu I and cloned into pCMV6-AN-Myc-DDK (PS100016, OriGene) at the Sgr I and Mlu Irestriction sites. Plasmids encoding the WT protease (LbWT) or the catalytically inactive mutant (LbC51A) of FMDV have been previously described (19). The NS1-IAV plasmi
FigureFigureFigure
Ramp sequence may explain synonymous variant association with Alzheimer's disease in the Paired Immunoglobulin-like Type 2 Receptor Alpha (PILRA)
Miller, Brandon, McKinnon et al
bioRxiv (2025)
Cited by 1
AI Summary: In this study, the pCMV6-AN-myc-DDK mammalian expression vector from OriGene (Catalog #PS100016) was used to express wildtype and mutant PILRA transcripts in CHO cells, enabling the authors to evaluate the effects of the synonymous variant on mRNA and protein levels.
Snippet: ow. Transfection of wildtype and mutant transcripts The wildtype and mutant sequences synthesized by GenScript Biotech were each inserted into separate mammalian expression vectors pCMV6-AN-myc-DDK (ORIGENE, Catalog #PS100016). Transformation protocols were followed as recommended by the manufacturer. In brief, plasmids were transformed into competent DH5a cells, amplified, and purified using the
FigureFigure
Inhibition of IRP2-dependent reprogramming of iron metabolism suppresses tumor growth in colorectal cancer
Hwang, Park, Kim et al
Cell Commun Signal (2024) 22 (1), 412 DOI: 10.1186/s12964-024-01769-6
Cited by 18
AI Summary: OriGene’s pCMV6-Myc-IRP2 plasmid (PS100016) was used to transfect HEK293T cells, enabling the study of IRP2 function and its inhibition in colorectal cancer models.
Snippet: HEK293T cell was transfected with the pCMV6-Myc-IRP2 plasmid (Origene, PS100016) for 36 h and then, treated with KS-20,073 for 24 h. After incubation, the medium was removed, followed by cross-linking using formalin (Tech and Innovation, BPP-9004)
FigureFigureFigure
Smad3 regulates smooth muscle cell fate and mediates adverse remodeling and calcification of the atherosclerotic plaque
Cheng, Wirka, Kim et al
Nat Cardiovasc Res (2022) 1 (4), 322-333 DOI: 10.1038/s44161-022-00042-8
Cited by 64
AI Summary: OriGene’s Myc-Flag-tagged SOX9 (PS100016) plasmid was used for co-immunoprecipitation experiments in this study to investigate protein interactions relevant to smooth muscle cell phenotypic transitions and atherosclerotic plaque remodeling.
Snippet: XB2–1C9 (1:50 (hybridoma supernatant)), or mouse anti-SOX9 monoclonal antibody (DSHB PCRP-SOX9–1A2 (1:50 hybridoma supernatant)). Co-immunoprecipitation Experiment Myc-Flag-tagged SOX9 (PS100016 Origene) and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells. …
Cancer-Associated SF3B1 Mutations Confer a BRCA-Like Cellular Phenotype and Synthetic Lethality to PARP Inhibitors
Lappin, Barros, Jhujh et al
Cancer Res (2022) 82 (5), 819-830 DOI: 10.1158/0008-5472.CAN-21-1843
AI Summary: OriGene products pCMV6-AN-Myc-DDK (PS100016) and pCMV6-AN-mRFP (PS100049) were used as plasmid controls in the study to investigate the effects of SF3B1 mutations on DNA damage response and sensitivity to PARP inhibitors.
Snippet: AATACAAA and siSCR – AGCAGCACGACTTCTTCAAGT. siBRCA1 - ACCATACAGCTTCATAAATAA Plasmids pCMV6-AN-Myc-DDK (PS100016;RRID:SCR_021264) and pCMV6-AN-mRFP (PS100049;RRID: SCR_021265) were purchased from Origene. Inducible GFP-RNAseH1 plasmid was generated via restriction cloning an RNH1-GFP cassette from pEGFP‐RNASEH1, a gift from Andrew Jackson and Martin Reijns (RRID: Addgene_108699) using BglII
FigureFigureFigure
G3BPs tether the TSC complex to lysosomes and suppress mTORC1 signaling
Prentzell, Rehbein, Cadena Sandoval et al
Cell (2021) 184 (3), 655-674.e27 DOI: 10.1016/j.cell.2020.12.024
Cited by 156
AI Summary: In this study, the OriGene pCMV6-AN-MYC-DDK (MYC-FLAG-empty) plasmid (Cat# PS100016) was used as a control vector for the generation and analysis of MYC-FLAG-tagged G3BP1 constructs, enabling the investigation of G3BP1's role in tethering the TSC complex to lysosomes and regulating mTORC1 signaling.
Snippet: … (2014) RRID: Addgene_52963 pCMV6-AN-MYC-DDK (MYC-FLAG-empty) Origene Cat# PS100016 MYC-FLAG-G3BP1 This paper N/A MYC-FLAG-G3BP1-ΔRGG (aa 410-466) This paper N/A MYC-FLAG-G3BP1-ΔNTF2L (aa 1-139) This paper N/A MYC-FLAG-G3BP1-NTF2L 1-139;., 2009) N/A bJun-HA-LN151 Gift from Qingming Luo, Wuhan, China (Chu et al., 2009) N/A lentiGuide-Puro Sanjana et al. (2014) RRID: Addgene_52963 pCMV6-AN-MYC-DDK (MYC-FLAG-empty) Origene Cat# PS100016 MYC-FLAG-G3BP1 This paper N/A MYC-FLAG-G3BP1-ΔRGG (aa 410-466) This paper N/A MYC-FLAG-G3BP1-ΔNTF2L (aa 1-139) This paper N/A MYC-FLAG-G3BP1-NTF2L 1-139;pCMV6-AN-MYC-DDK (MYC-FLAG-empty) Origene Cat# PS100016 MYC-FLAG-G3BP1 This paper N/A
Showing 1-6 of 13 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products