OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCMV6-A-Puro Mammalian Expression Vector

Be the first to review this product
SKU
PS100025
pCMV6-A-Puro, mammalian vector with puromycin as mammalian selection marker, 10ug
  $470.00
In Stock*

Frequently Bought Together (3)

GE100111 Forward primer to sequence targets cloned in expression vectors.
1 nmol
$71.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00
Specifications
Specifications
Product Data
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Puromycin
Expression Promoter CMV
Features
  • This vector is essentially the same as the pCMV6-Entry vector, except for the alternative selection marker (Puromycin instead of Neomycin).
  • The vector itself does not contain additional tag. If the insert is shuttled from pCMV6-Entry via SgfI/AscI and RsrII/MluI, it will express non-tagged protein. If the insert is shuttled from the pCMV6-Entry vector using SgfI/AscI and Pme I, then it will express Myc-DDK tagged protein.
  • V2_F Primer can be used to sequence the target sequence after cloning.
  • XL39_R Primer can be used to sequence the target sequence after cloning.
Download Vector Sequence
Schematic of the multiple cloning sites
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Cell-type-specific dysregulation of mitochondrial calcium signaling in Alzheimer's disease
Shukla, Kadam, Goyani et al
Cell Commun Signal (2025) 23 (1), 472 DOI: 10.1186/s12964-025-02460-0
Cited by 9
AI Summary: OriGene’s pCMV6-A-Puro plasmid (Cat# PS100025) was used as a vector backbone for generating stable cell lines expressing APP mutations, enabling the study of mitochondrial calcium signaling dysregulation in different brain cell types in Alzheimer’s disease.
Snippet: APPswe/F/L plasmid was purchased from Vecto Builder (Cat# VB220324-1227aqs) and pCMV6-A-Puro (Cat# PS100025) was purchased from Origene. … MethodsPlasmids and chemicals APPswe/F/L plasmid was purchased from Vecto Builder (Cat# VB220324-1227aqs) and pCMV6-A-Puro (Cat# PS100025) was purchased from Origene. …
FigureFigureFigure
Mitochondrial Ca2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity
Weissenrieder, Peura, Paudel et al
Cell Rep (2025) 44 (5), 115627 DOI: 10.1016/j.celrep.2025.115627
Cited by 13
AI Summary: OriGene’s pCMV6-A-EV-puro plasmid (PS100025) was used in this study to facilitate gene expression experiments investigating the role of mitochondrial Ca2+ uptake in pancreatic cancer cell plasticity and metastasis.
Snippet: pCMV6-A-EV-puro Origene PS100025 pCDH-Snail-blasti N/A pCDH-EV-blasti
Synthesis, radiolabeling, and biological evaluation of methyl 6-deoxy-6-[18F]fluoro-4-thio-α-d-maltotrioside as a positron emission tomography bacterial imaging agent
Takemiya, Seo, Voll et al
RSC Adv (2025) 15 (11), 8809-8829 DOI: 10.1039/d5ra00693g
Cited by 2
AI Summary: OriGene’s pCMV6-A-puro plasmid (PS100025) was used as the mammalian expression vector for constructing SGLT1-overexpressing cells, enabling the study of [18F]MFTMT and [18F]MFTM uptake in vitro.
Snippet: 2 were evaluated by the expression relative to β-actin. Interaction of [18F]MFTMT with SGLTs Plasmid construction The mammalian expression vector, pCMV6-A-puro plasmid (PS100025), was obtained from OriGene. Restriction enzymes, ligation enzymes, and T4 polymerase were obtained from New England Biolabs. To modify the muti-cloning site (MCS), the MCS template (gcggacggtgagtactggatgaaccgaggagagatat
FigureFigureFigure
A distinct isoform of lymphoid enhancer binding factor 1 (LEF1) epigenetically restricts EBV reactivation to maintain viral latency
Ward, Prasai, Schaal et al
PLoS Pathog (2023) 19 (12), e1011873 DOI: 10.1371/journal.ppat.1011873
Cited by 11
AI Summary: OriGene’s pCMV6-A-puro (PS100025) and pCMV6-entry vector-neo (PS100001) plasmids were used to overexpress specific LEF1 isoforms, enabling the study to determine how these variants epigenetically restrict EBV reactivation and maintain viral latency.
Snippet: used as a normalization control. Negative controls included reverse transcriptase-negative reactions and water as template. Primers are listed in S3 Table. LEF1 overexpression analysis pCMV6-A-puro (ORIGENE PS100025) vector was used for expression of LEF1 variants. LEF1 variant 3 (NM_001130714) and variant 4 (NM_001166119) encoding DNA fragments were shuttled from pCMV6-entry vector-neo (PS100001
FigureFigureFigure
The Role of Host Transcription Factor LEF1 in the Epstein-Barr Virus Life Cycle
Ward
Thesis (2023)
Snippet: NOKs-Akata were seeded at 5 × 105 in 6 well plates and transfected with 2 µg DNA. Cells were transfected with vector control, pCMV6-A-puro (ORIGENE PS100025), pCMV6-A-LEF1variant 3 or pCMV6-A-LEF1variant4-puro. Cells were placed under selection for 72 hours in 0.7 µg/mL puromycin. EBV was maintained in puromycin resistant cells via re-introduction of G418 sulfate following removal of puromycin
PHAROH lncRNA regulates Myc translation in hepatocellular carcinoma via sequestering TIAR
Yu, Berasain, Bhatia et al
Elife (2021) 10 DOI: 10.7554/eLife.68263
AI Summary: In this study, OriGene's Myc (MR207416) and TIAR (MR225099) expression plasmids were used to rescue and analyze the effects of PHAROH depletion on MYC and TIAR protein levels, contributing to the investigation of PHAROH lncRNA's regulatory role in hepatocellular carcinoma.
FigureFigureFigure
Showing 1-6 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products