OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCMV6-A-Hygro Mammalian Expression Vector

Be the first to review this product
SKU
PS100024
pCMV6-A-Hygro, mammalian vector with hygromycin as mammalian selection marker, 10ug
  $470.00
In Stock*

Frequently Bought Together (3)

GE100111 Forward primer to sequence targets cloned in expression vectors.
1 nmol
$71.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00
Specifications
Specifications
Product Data
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Hygromycin
Expression Promoter CMV
Features
  • This vector is essentially the same as the pCMV6-Entry vector, except for the alternative selection marker (Hygromycin instead of Neomycin).
  • The vector itself does not contain additional tag. If the insert is shuttled from pCMV6-Entry via SgfI/AscI and RsrII/MluI, it will express non-tagged protein. If the insert is shuttled from the pCMV6-Entry vector using SgfI/AscI and Pme I, then it will express Myc-DDK tagged protein.
  • V2_F Primer can be used to sequence the target sequence after cloning.
  • XL39_R Primer can be used to sequence the target sequence after cloning.
Download Vector Sequence
Schematic of the multiple cloning sites
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Two independent respiratory chains adapt OXPHOS performance to glycolytic switch
Fernández-Vizarra, López-Calcerrada, Sierra-Magro et al
Cell Metab (2022) 34 (11), 1792-1808.e6 DOI: 10.1016/j.cmet.2022.09.005
Cited by 96
AI Summary: In this study, OriGene products—including COX7A2L-Myc-DDK (Cat# RC202697), COX7A1-Myc-DDK (Cat# RC201154), COX7A2-Myc-DDK (Cat# RC215973), and pCMV6-A-Entry-Hygro (Cat# PS100024)—were used to investigate the roles of COX7A subunit isoforms in organizing mitochondrial respiratory chain structures and adapting oxidative phosphorylation to metabolic changes.
Snippet: pSp-CAS9(BB)-2A-GFP (PX458) Ran et al., 2013 Addgene# 48138 COX7A2L- Myc-DDK Origene Cat#RC202697 COX7A1- Myc-DDK Origene Cat#RC201154 COX7A2- Myc-DDK Origene Cat#RC215973 pCMV6-A-Entry-Hygro Origene Cat# PS100024 COX7A2L-Myc-DDK in pCMV6-A-Entry-Hygro Lobo-Jarne et al., 2018 N/A
Tissue-specific mitochondrial HIGD1C promotes oxygen sensitivity in carotid body chemoreceptors
Timón-Gómez, Scharr, Wong et al
Elife (2022) 11 DOI: 10.7554/eLife.78915
AI Summary: OriGene products HP234519 (TH-F and TH-R primers) were used in this study to analyze gene expression related to oxygen sensing in carotid body chemoreceptors.
Snippet: This paper COX4I2-R: CTTCTCCTTCTCCTTCAGGG This paper NDUFA4L2-F: GATGATCGGCTTAATCTGCC This paper NDUFA4L2-R: GTATTGGTCATTGGGGCTCA This paper TH-F: GCTGGACAAGTGTCATCACCTG OriGene HP234519 TH-R: CCTGTACTGGAAGGCGATCTCA OriGene HP234519 OR51E2-F2: TCATCCCATTGTGCGTGTTG This paper OR51E2-R2: CACCCGTGTTCTGATCTGTTTG This paper   BaseScop
FigureFigureFigure
Balanced mitochondrial and cytosolic translatomes underlie the biogenesis of human respiratory complexes
Soto, Couvillion, Hansen et al
Genome Biol (2022) 23 (1), 170 DOI: 10.1186/s13059-022-02732-9
Cited by 123
AI Summary: OriGene products contributed to this study by providing the Myc-DDK tagged LRPPRC ORF plasmid (CAT: RC216747) and the hygromycin resistance-containing pCMV6 entry vector (CAT: PS100024), which were used to generate reconstituted cell lines for investigating the coordination of mitochondrial and cytosolic translation in OXPHOS complex biogenesis.
Snippet: …To create the reconstituted cell line, a Myc-DDK tagged LRPPRC ORF plasmid was obtained from OriGene (CAT: RC216747). This ORF was then subcloned into a hygromycin resistance-containing pCMV6 entry vector (OriGene, CAT PS100024). … To create the reconstituted cell line, a Myc-DDK tagged LRPPRC ORF plasmid was obtained from OriGene (CAT: RC216747). This ORF was then subcloned into a hygromycin resistance-containing pCMV6 entry vector (OriGene, CAT PS100024). …
FigureFigureFigure
Coordination of metal center biogenesis in human cytochrome c oxidase
Nývltová, Dietz, Seravalli et al
Nat Commun (2022) 13 (1), 3615 DOI: 10.1038/s41467-022-31413-1
Cited by 120
AI Summary: OriGene's CRISPR-CAS9 guide RNAs (KN210770 and KN203238) were used to generate stable COX19 and COX11 knockout HEK293T cell lines, enabling the study of metal center biogenesis in human cytochrome c oxidase.
Snippet: … To create stable human COX19-KO and COX11-KO lines in HEK293T cells, we used CRISPR-CAS9 guide RNAs obtained from OriGene (KN210770 and KN203238, respectively) designed to bind the exon 1 region of the corresponding gene (Supplementary Fig. 1). 1.5 × 106 HEK293T cells were transfected with 4 µg of the r;- To create stable human COX19-KO and COX11-KO lines in HEK293T cells, we used CRISPR-CAS9 guide RNAs obtained from OriGene (KN210770 and KN203238,
Fusion with Promiscuous Gα16 Subunit Reveals Signaling Bias at Muscarinic Receptors
Randáková, Nelic, Hochmalová et al
Int J Mol Sci (2021) 22 (18) DOI: 10.3390/ijms221810089
Cited by 3
AI Summary: OriGene’s pCMV6-A-Hygro plasmid was used as a mammalian selection vector to construct fusion proteins for studying signaling bias at muscarinic receptors.
Snippet: Plasmid pCMV6-A-Hygro containing hygromycin as a mammalian selection marker was purchased from Origene (Rockville, MD, USA)
Migraine therapeutics differentially modulate the CGRP pathway
Bhakta, Vuong, Taura et al
Cephalalgia (2021)
Cited by 101
AI Summary: OriGene’s pCMV6-A-Puro vector was used to clone synthesized RAMP2 and RAMP3 constructs, enabling functional and binding assays to compare the mechanisms of different migraine therapeutics targeting the CGRP pathway.
Snippet: BackgroundThe clinical efficacy of migraine therapeutic agents directed towards the calcitonin-gene related peptide (CGRP) pathway has confirmed the key role of this axis in migraine pathogenesis. ...;RAMP2, NM_005854, 36-175;RAMP3, NM_005856, 29-148) were synthesized by Integrated DNA Technologies, then cloned into pCMV6-A-Puro (OriGene)
Showing 1-6 of 12 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products