CRISPR/CAS9 FAQs

1. A 20bp target sequence is needed with a NGG PAM seq. Shall the NGG be exactly immediately following the 3′ of this 20bp sequence?

Yes, the NGG is located immediately next to the 3′ end of the 20bp sequence in the genome. However NGG is not included in the guide RNA sequence.

2. How to design the 20bp target-specific sequence?

The 20bp target-specific sequence should precede NGG (PAM). Please BLAST the seed region (8-14 bp PAM-proximal) of the 20bp target sequence to make sure it’s unique along the genome to guarantee its specificity.

3. How to avoid off target issue using CRISPR/Cas?

You can blast your target sequences. If the off-target sequences don’t have the PAM (NGG), then they won’t be targeted by CRISPR/Cas9. You also want to choose target sequences with mismatches in the 8-14 bp at the 3’ end of the target sequences. This way, the off-target issue can be decreased dramatically. For therapeutic purpose, you can use Cas9 nickase which only cuts one strand.

4. How many target RNA sequences should I use for a genome editing project?

Due to the un-predicable nature of gRNA, we recommend 3 and more gRNA targeting sequences to be designed to make sure that at least one targeting sequence will provide efficient cleavage.

5. Do you know the specific cleavage site of the Cas:gRNA complex in terms of where in the targeting sequence the cleavage occurs?

Cas9 cleaves at 3 bp away from the 3’ end of the target sequence in the genome.

6. Why I cannot find the gRNA targeting sequences in the cDNA sequence?

The targeting sequences could be located in either exon or intron in the genome; the cDNA sequences only contain the exons. CRISPR/Cas9 will target the genomic sequence, then genome editing will be achieved.

7. Why do you need T7-driven vector to express gRNA and Cas9?

For making gene knockout mice and genome editing in other organisms, such as Drosophila, some researchers do microinjection of gRNA and Cas9 mRNA into cells.

8. The transfection efficiency of my cell line is only 20%, how to enrich CRISPR transfected cells?

You can use pCas-Guide-EF1a-GFP to enrich transfected cells since GFP is also expressed. We also have pCas-Guide-EF1a-CD4 vector; you can use anti-CD4 antibody beads to enrich transfected cells. Alternatively, you can transfect a plasmid with a selection marker and select the cells. Lenti vector can be used and integration-deficient lentivirus can be produced using the special integration-deficient lenti packaging kit (cat# TR30036); the lenti CRISPR vectors can be delivered into hard-to-transfect cells, but not integrating into the host genome.

9. Is there a method for isolating single cell colonies from the engineered pool of cells?

series of dilution or Isolating individual cell colonies using cloning cylinders.

10. Do you need to linearize a donor template before transfection for efficient repair?

The donor template DNA is not preferred to be linearized as this will increase random integration.

11. How to select edited clones if using long oligos as a donor template?

Isolate single cell colonies, do WB (for gene knockout or tagging) or genomic PCR or sequencing (for mutations) to detect the genome editing depending on the nature of the editing.

12. How to screen the edited cells after transfecting the CRISPR/Cas9 vector?

For mutations, you can do genomic PCR and sequence it. If you do gene knockout, the selection marker in the donor template DNA will help the selection. If no donor DNA for gene knockout out, then genomic PCR and sequencing to confirm indels. If necessary, you can isolate individual cell colonies for introduction of specific mutations and other genome editing applications. You can do WB for gene knockout after isolating single cell colonies.

13. Does CRISPR/Cas system work for non-dividing cells?

NHEJ repair works in non-dividing cells; HDR is not active in non-dividing cells.

14. Using CRISPR, can you get monoallelic knockout (heterozygous) or biallelic knockout (homozygous)?

CRISPR/Cas9 double-strand cleavage is very efficient. If just using CRISPR/Cas9 vectors to introduce indels, if transfection efficiency is high, more biallelic knockout can occur. In the presence of donor DNA, since homologous recombination may be a limiting factor, some cells contain monoallelic knockout and some cells contain biallelic knock out.

15. Do you have the cas9 antibody?

Yes, We do have Cas9 antibody (cat# TA190309). In our CRISPR/Cas9 vectors, Cas9 has a C-terminal Myc-DDK tag. DDK is the same as Flag; OriGene’s anti-DDK antibody (SKU TA50011-100).

16. If I want to use CRISPR/Cas9 to knock down a certain gene, what kind of negative control should I use?

You can use a scramble control, pCas-Scramble, SKU GE100003, or pCas-Scramble-EF1a-GFP, SKU GE100021.

17. For gene targeting in mice, do you recommend transfecting ES cells or pronuclei?

You can do both. You can inject mRNA (gRNA and Cas9 mRNA) or plasmid DNA (target sequence cloned pCas-Guide) into the zygotes or ES cells.

18. What is the limit for multiple gene disruption?

You can do multiplexes using CRISPR/Cas9 system. You can co-transfect the gRNA vectors or co-inject several guide RNAs into your cells; so you will achieve multiple gene disruption or genome editing. The limit could be transfection efficiency.

19. How do you make sure that Cas9 will not integrate in genome if you use lentivector?

For screening purpose, for short term, integration of Cas9 into the genome for 2 weeks does not affect cells. You can also use the integration-deficient lenti packaging kit to produce lentivirus that won’t integrate into the cellular genome, acting just like plasmid.

20. Can you introduce mutations anywhere in the genome, including in promoters or enhancers?

Yes. The 20 bp target sequences only need to precede NGG.

21. Do you see variability in success with different cell lines?

Yes, depending on the cell line and the gRNA sequences.

22. What is the known CRISPR/Cas9 editing efficiency relative to other genome editing approaches?

In general, the genome editing efficiency of CRISPR/Cas9 is similar or higher than TALEN. However, CRISPR/Cas9 is much more simple and easy to do. You will need to engineer the protein to recognize new DNA sequence in TALEN system, while CRISPR/Cas9 is RNA based.

23. What is the sequence of CF3 sequencing primer?

5’-ACGATACAAGGCTGTTAGAGAG-3’

24. What is the scrambled sequence in pCas-Scramble and pCas-Scramble-EF1a-GFP?

5’ GCACTACCAGAGCTAACTCA 3’

25. Do you provide gRNA cloning service and donor vector service?

Yes, you can order gRNA cloning service and donor vector service.

26. Is there any safety issue with this pLenti vector?

The pLenti vector is a third generation lentiviral vector and it is the safest lenti-viral vector because both LTRs are truncated. Please contact the biosafety office at your institution prior to use of the pLenti vector for permission and for further institution-specific instructions. BL2/(+) conditions should be used at all times when handling lentivirus. All decontamination steps should be performed using 70% ethanol/1% SDS. Gloves should be worn at all times when handling lentiviral preparations, transfected cells or the combined transfection reagent and lentiviral DNA.

27. What is unique about the 3rd generation Lentiviral vectors?

The 3rd generation lentiviral vectors are safer than the 2nd generation vectors. The 3rd generation packaging systems express gag and pol from one packaging vector and rev from another. The 3rd generation packaging systems DO NOT express tat (Trans-Activator of Transcription).

28. Can I use a second generation packaging system with the pLenti vectors?

Yes, a second generation packaging system should work with OriGene’s third generation pLenti vectors although we have not explicitly tested this. You can use OriGene’s high efficient third generation lenti-packaging kit (cat# TR30037) for pLenti-vectors.

29. How can I sequence the target sequenced cloned in pT7-Guide vector?

M13 forward primer, 5’ CGCCAGGGTTTTCCCAGTCACGAC 3’

30. For knocking down a target gene, donor plasmid is not necessary, correct?

Without donor template DNA, the double-stranded break will be repaired by NHEJ; unpredicted indels will be introduced. You will screen the deletions/insertions that cause frame shift. With donor DNA, you will get desired insertion/deletion/mutations. With donor DNA, you will have mammalian selection.

31. How long should the LHA and RHA be?

600-1000 bp left or right homologous arms should work for HDR mediated repair.

32. What is your validation data for your CRISPR knockout / knockin kit?

Please see the downloadable validation data at https://www.origene.com/products/gene-expression/crispr-cas9

33. How to knockout all the splicing variants of a gene using OriGene’s pre-designed donor vectors, eg. OriGene’s CRISPR knockout / knockin kit?

Different splice variants of a gene are generated from the same pre-mRNA, splicing at different locations. When we design target sequences to knockout all the splicing forms of a gene, the target sequences are located around the start codon, ATG, of the longest splice variant. The 3’ end of the left homologous arm in the donor vector is right upstream of the start codon ATG. After inserting a donor selection cassette, all of the splicing variants are not expressed.

34. Do I get monoallele knock-out or biallele knock-out using the homology-mediated knock-out kit via CRISPR? What do I need to do to get biallele knock-out?

If you isolate single cell colonies, in some cells gene knock-out may occur only in one allele; in some cells gene knock-out may occur in both alleles. If you only have monoallelic knockout and you want to get biallelic knockout, you can order another donor vector containing a different mammalian selection marker, such as blastocidin or neomycin resistant marker. Make sure the other allele is intact as it can be targeted and repaired via NHEJ; confirm with genomic PCR and sequencing. OriGene has both functional cassettes. You can do the knockout procedure again with the new donor vector to target the second allele (one allele is already targeted and replaced with GFP-puro cassette). Alternatively, you can use Cre to flox out the puro cassette from your edited cells and use the same donor vector from the knockout kit and do the knockout again to target the second allele.

35. What is the sequence of the reverse primer at the GFP region to amplify the left integration region using the homology-mediated CRISPR knockout / knockin kit?

tGFP-integeration_3R; TAGGTGCCGAAGTGGTAGAAGC

36. What’s the mechanism for KN2.0 CRISPR gene knockout kits mediated gene knock out and targeted donor integration?

KN2.0 is designed based on targeted genome editing technology (CRISPR-Cas9). Target specific gRNA will cut the genome, then the donor DNA containing selection cassette will be integrated at the cutting site via NHEJ (non-homologous end joining) mediated repair mechanism. The donor cassette can be integrated at forward or reverse direction. Most gene knockout are bioallelic, one allele has donor integration, the other allele has indels (insertion and deletion).

37. What are the advantages of KN2.0 CRISPR gene knockout kits?

Although homology directed recombination (HDR)-mediated gene knockout/knockin is well established, it cannot necessarily be applied in some cell types and organisms with low HDR efficiency. CRISPR KN 2.0 is specifically designed to provide a universal solution for gene knockout needs in every cell type and organism. Studies carried out in house and by collaborators show that CRISPR KN 2.0 is highly efficient and render improved knockout rate.

38. How many cell lines have been tested for KN2.0?

KN2.0 has successfully tested in HeLa, HEK293T and MIA PaCa-2 (a human pancreatic carcinoma cell line) cells.

39. If after puromycin selection using KN2.0 kit, I have no sells survived, what could be the reason?

Two possibilities. 1. The gene is an essential cell survival gene, so constitutive gene knockout can not be tolerated. Conditional knockout is needed. 2. Transfection efficiency is too low. Transfection optimization or selecting different transfection method is needed, such as electroporation.

40. Can KN2.0 be used for embryo microinjection to generate transgenic animal models?

Theoretically, KN2.0 can be used for embryo microinjection to generate transgenic animal model. However, this has not been tested in our facility and optimization is warranted.

41. What could be the reason that I couldn’t get my gene of interest knocked out?

If your target gene is essential for cell survival, you might not be able to get constitutive gene knockout. Conditional gene knockout may be needed.