Sequencing Primer, XL39-R

CAT#: GE100137

Reviews ()
Write a review

Reverse primer to sequence targets cloned in expression vectors.



USD 66.00


Availability*
In Stock

Size
    • 1 nmol

Product images

Specifications

Product Data
Forward Sequence 5' ATTAGGACAAGGCTGGTGGG 3'
Applicable Vectors PS100001, PS100002, PS100004, PS100005, PS100006, PS100007, PS100008, PS100009, PS100011, PS100012, PS100013, PS100014, PS100016, PS100017, PS100018, PS100019, PS100020, PS100022, PS100024, PS100025, PS100026, PS100033, PS100035, PS100047, PS100048, PS100049, PS100051, PS100052, PS100055, PS100056, PS100057, PS100058, PS100061, PS100066, PS100067, PS100089, PS100111
Components 1 vial of lyophilized squencing primer (1 nmol, sufficient for 100 sequencing reactions)
Quality Control The primer has been tested to generate satisfactory squencing data on ABI 3730.
Storage Store at -20°C.
Stability The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C

Documents

Frequently bought together (4)
CAS9 mouse monoclonal antibody,clone OTI5E5
    • 100 ul

USD 417.00


Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 138.00


Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 138.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools