pCMV6-AN-mRFP Mammalian Expression Vector

Snippet: μg/ml), along with LysoTracker Red DND-99 (50 nM, Cat# L7528;Invitrogen), for 1 h at 37°C. In the colocalization study, human astrocytes were transfected with a SLC38A9-RFP plasmid (Cat# PS100049;OriGene). After 48 h, the cells were treated with 100 nM FITC-labeled Tat protein (Cat# 1002-F;ImmunoDX) or 50 nM LysoTracker Red DND-99 (Cat# L7528;Invitrogen) for 1 h at 37°C. The cells were then

Snippet: For co- localization of Tat with TLR7, human astrocytes were transfected with a plasmid encoding TLR7- RFP (Origene, cat#PS100049). 48 h posttransfection, the cells

Snippet: AATACAAA and siSCR – AGCAGCACGACTTCTTCAAGT. siBRCA1 - ACCATACAGCTTCATAAATAA Plasmids pCMV6-AN-Myc-DDK (PS100016;RRID:SCR_021264) and pCMV6-AN-mRFP (PS100049;RRID: SCR_021265) were purchased from Origene. Inducible GFP-RNAseH1 plasmid was generated via restriction cloning an RNH1-GFP cassette from pEGFP‐RNASEH1, a gift from Andrew Jackson and Martin Reijns (RRID: Addgene_108699) using BglII

Snippet: To generate N-terminally RFP-tagged MAPKBP1, pCMV6-AN-mRFP (OriGene Technologies, Rockville, Maryland, US) and pcDNA3.1D_JNKBP1/2xDDK-His-TOPO were digested with FastDigest MssI and FastDigest HindIII (FD1344, Thermo Fisher Scientific, US)

Snippet: The selected colonies were checked by DNA sequence verification. The cDNA encoding full- length XRCC1 and residues 166-436 was amplified by PCR and inserted into the bacterial expression plasmid pEX-N-His (OriGene, Rockville, MD) using AscI-RsrII restriction