p53 (TP53) (NM_000546) Human Over-expression Lysate
$206.00
2 Weeks*
Specifications
| Product Data | |
| Species | Human |
|---|---|
| Expression Host | HEK293T |
| Expression cDNA Clone or AA Sequence | TrueORF Clone RC200003 |
| Tag | C-Myc/DDK |
| Detection Antibodies | Clone OTI4C5, Anti-DDK (FLAG) monoclonal antibody (TA50011-100) |
| ACCN | NM_000546, NP_000537 |
| Synonyms | BCC7; BMFS5; LFS1; P53; TRP53 |
| Predicted MW | 43.7 kDa |
| Components | 1 vial of 20 ug lyophilized total protein derived from gene specific transient over-expression cell lysate |
| Storage | The lysate can be shipped at ambient temperature, however upon receipt of the sample store at -20°C. Lysate samples are stable for 12 months from the date of receipt when stored at -20°C in their original lyophilized form. After reconstitution, avoid repeat freeze thaw cycles and store at -80°C. Lysate samples are stable for 12 months from date of receipt when stored at -20°C. |
| Shipping | Blue Ice |
| Preparation | HEK293T cells in 10-cm dishes were transiently transfected with MegaTran Transfection Reagent (TT200002) and 5ug TrueORF cDNA plasmid. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix (Sigma), 1mM PMSF and 1mM Na3VO4), and then centrifuged to clarify the lysate. Protein concentration was measured by BCA kit (Thermo Scientific Inc.). To facilitate transportation and protein, the products are supplied as lyophilized proteins. |
| Reconstitution Method | The 20 µg lyophilized sample can be reconstituted with deionized water, or directly into 1x SDS-PAGE running buffer (with reducing agent) if the sample is being prepared directly to be run on a gel. The lyophilized 20 ug product is derived from a liquid solution at 1 mg/ml of total lysate protein, thus reconstituting back to 1 mg/ml using 20 µl is recommended. After reconstitution, avoid repeat freeze thaw cycles and store at -80°C. |
| Reference Data | |
| RefSeq | NP_000537 |
| Locus ID | 7157 |
| Cytogenetics | 17p13.1 |
| Protein Families | WB |
| Protein Pathways | Amyotrophic lateral sclerosis (ALS), Apoptosis, Basal cell carcinoma, Bladder cancer, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, Glioma, Huntington's disease, MAPK signaling pathway, Melanoma, Neurotrophin signaling pathway, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer, Thyroid cancer, Wnt signaling pathway |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
| Recombinant Protein Resources |
Other "p53" proteins (16)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| PH300003 | TP53 MS Standard C13 and N15-labeled recombinant protein (NP_000537) | 10 ug |
$3,360.00
|
|
| PH325502 | TP53 MS Standard C13 and N15-labeled recombinant protein (NP_001119586) | 10 ug |
$3,360.00
|
|
| PH325604 | TP53 MS Standard C13 and N15-labeled recombinant protein (NP_001119584) | 10 ug |
$3,360.00
|
|
| LC426652 | Lyophilized TP53 HEK293T cell transient overexpression lysate (as WB positive control) | 20 ug |
$206.00
|
|
| LC426653 | Lyophilized TP53 HEK293T cell transient overexpression lysate (as WB positive control) | 20 ug |
$206.00
|
|
| LC426654 | Lyophilized TP53 HEK293T cell transient overexpression lysate (as WB positive control) | 20 ug |
$206.00
|
|
| LY400186 | Transient overexpression lysate of tumor protein p53 (TP53), transcript variant 1 (as WB positive control) | 100 ug |
$436.00
|
|
| LY426652 | Transient overexpression lysate of tumor protein p53 (TP53), transcript variant 2 (as WB positive control) | 100 ug |
$436.00
|
|
| LY426653 | Transient overexpression lysate of tumor protein p53 (TP53), transcript variant 4 (as WB positive control) | 100 ug |
$436.00
|
|
| LY426654 | Transient overexpression lysate of tumor protein p53 (TP53), transcript variant 3 (as WB positive control) | 100 ug |
$436.00
|
|
| TP300003 | Recombinant protein of human tumor protein p53 (TP53), transcript variant 1, 20 µg | 20 ug |
$867.00
|
|
| TP325502 | Purified recombinant protein of Homo sapiens tumor protein p53 (TP53), transcript variant 3, 20 µg | 20 ug |
$867.00
|
|
| TP325604 | Recombinant protein of human tumor protein p53 (TP53), transcript variant 2, 20 µg | 20 ug |
$867.00
|
|
| TP701001 | Purified recombinant protein of human tumor protein P53 (TP53), transcript variant 1, mutant (Y220C), expressed in HEK293 cells, 20ug | 20 ug |
$900.00
|
|
| TP710022 | Recombinant protein of human tumor protein p53 (TP53), transcript variant 1, full length, with C-terminal DDK tag, expressed in sf9 cells. | 20 ug |
$540.00
|
|
| TP750119 | Purified recombinant protein of Human tumor protein p53 (TP53), transcript variant 1, full length, N-terminal His and GST tag, expressed in E. coli, 50ug | 50 ug |
$270.00
|
|
Citations
O-GlcNAcylated p53 in the liver modulates hepatic glucose production
Gonzalez-Rellan, Fondevila, Fernandez et al
Nat Commun (2021) 12 (1), 5068 DOI: 10.1038/s41467-021-25390-0
Gonzalez-Rellan, Fondevila, Fernandez et al
Nat Commun (2021) 12 (1), 5068 DOI: 10.1038/s41467-021-25390-0
Cited by 73
AI Summary: In this study, OriGene products—including the human p53 expression plasmid (RC200003) and p53 shRNA lentiviral particles (TL320007)—were used to manipulate p53 levels in hepatocytes, enabling the authors to investigate the role of O-GlcNAcylated p53 in regulating hepatic glucose production.
AXL Inactivation Inhibits Mesothelioma Growth and Migration via Regulation of p53 Expression
Song, Wang, Lu et al
Cancers (Basel) (2020) 12 (10) DOI: 10.3390/cancers12102757
Song, Wang, Lu et al
Cancers (Basel) (2020) 12 (10) DOI: 10.3390/cancers12102757
Cited by 21
AI Summary: OriGene's AXL and p53 expression plasmids were used in this study to investigate how manipulating AXL and p53 levels affects mesothelioma cell growth, migration, and the regulatory feedback between AXL and p53.
Snippet: … Our previous reports implicate AXL overexpression, activation, and regulation of downstream intermediates including PI3K/AKT/mTOR and RAF/MAPK in mesothelioma tumorigenesis [11,12]. AXL also has tumorigenic roles in carcinomas. For example, AXL regulation of miR-374a and miR-548b conferred drug resistance to EGFR inhibitors such as gefitinib in non-small cell;The Bio-Rad iScriptTM cDNA synthesis Kit and iQ SYBR green supermix were obtained from Bio-Rad Laboratories (Hercules, CA, USA). Lentiviral shRNA constructs were from The RNAi Consortium (TRC, Cambridge, MA, USA), and included AXL: GCTGTGAAGACGATGAAGATT;and p53: CTTCGACTATCTCAAACTCCT. AXL and p53 expression plasmid was purchased from Origene Technologies, Inc. … The luciferase reporters of luc-p53 (−2.4 kb) promoter has been described previously [40,41]. …
CELF1/p53 axis: a sustained antiproliferative signal leading to villus atrophy under total parenteral nutrition
Yan, Zhang, Dai et al
FASEB J. (2018)
Yan, Zhang, Dai et al
FASEB J. (2018)
AI Summary: OriGene products, specifically CELF1 (sc128043/rn204942) and p53 (sc119832/rn201296) expression plasmids, were used in this study to manipulate gene expression in cell models, enabling the authors to investigate the role of the CELF1/p53 axis in suppressing intestinal epithelial cell proliferation during total parenteral nutrition-induced villus atrophy.
Interaction of mutant hepatitis B X protein with p53 tumor suppressor protein affects both transcription and cell survival
Iyer, Groopman
Mol. Carcinog. (2011) 50 (12), 972-80 DOI: 10.1002/mc.20767
Iyer, Groopman
Mol. Carcinog. (2011) 50 (12), 972-80 DOI: 10.1002/mc.20767
Cited by 25
AI Summary: OriGene’s p53 expression plasmid was used in this study to investigate how wild-type and mutant hepatitis B X proteins interact with p53 and influence gene transcription and cell survival.
Snippet: with 5 µg of either WtHBx or MutHBx or empty vector pTracer (mock) and 5 µg of p53 expression plasmid (OriGene, Rockville, MD) per ... These details will need to be uncovered over the course of additional experiments, but the findings may provide important clues for additional
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
