p53 (TP53) (NM_000546) Human Tagged ORF Clone
$457.00
In Stock*
Specifications
| Product Data | |
| Type | Human Tagged ORF Clone |
|---|---|
| Target Symbol | p53 |
| Synonyms | BCC7; BMFS5; LFS1; P53; TRP53 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Chromatograms |
Chromatograms
 Sequencher program is needed, download here |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_000546 |
| ORF Size | 1179 bp |
| OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_000546.6 |
| RefSeq Size | 2591 bp |
| RefSeq ORF | 1182 bp |
| Locus ID | 7157 |
| UniProt ID | P04637, K7PPA8, Q53GA5 |
| Cytogenetics | 17p13.1 |
| Domains | P53 |
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
| Protein Pathways | Amyotrophic lateral sclerosis (ALS), Apoptosis, Basal cell carcinoma, Bladder cancer, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, Glioma, Huntington's disease, MAPK signaling pathway, Melanoma, Neurotrophin signaling pathway, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer, Thyroid cancer, Wnt signaling pathway |
| MW | 43.7 kDa |
| Summary | This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). provided by RefSeq, Dec 2016 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_000546" in other vectors (6)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC200003L1 | Lenti ORF clone of Human tumor protein p53 (TP53), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
| RC200003L2 | Lenti ORF clone of Human tumor protein p53 (TP53), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
| RC200003L3 | Lenti ORF clone of Human tumor protein p53 (TP53), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
| RC200003L4 | Lenti ORF clone of Human tumor protein p53 (TP53), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
| RG200003 | TP53 (tGFP-tagged) - Human tumor protein p53 (TP53), transcript variant 1 | 10 ug |
$489.00
$657.00
|
|
| SC119832 | TP53 (untagged)-Human tumor protein p53 (TP53), transcript variant 1 | 10 ug |
$686.00
|
|
Citations
Interaction of ROMK2 channel with lipid kinases DGKE and AGK: Potential channel activation by localized anionic lipid synthesis
Krajewska, Możajew, Filipek et al
Biochim Biophys Acta Mol Cell Biol Lipids (2023) 1869 (2), 159443 DOI: 10.1016/j.bbalip.2023.159443
Krajewska, Możajew, Filipek et al
Biochim Biophys Acta Mol Cell Biol Lipids (2023) 1869 (2), 159443 DOI: 10.1016/j.bbalip.2023.159443
Cited by 4
AI Summary: OriGene contributed to this study by providing pCMV6-Entry plasmids encoding FLAG-tagged proteins—specifically PRDX1, GPATCH8, TP53, IMPDH2, AGK, PARP1, and DGKE—which were used in co-immunoprecipitation experiments to investigate protein interactions with the ROMK2 channel.
Snippet: ectors with pCMV6-Entry plasmid backbone, which express proteins with Myc-FLAG-tags (in this study referred to as FLAG tag only) for Co-IP were obtained from OriGene for the following proteins: PRDX1 (cat. no. RC205072), GPATCH8 (cat. no. RC219640), TP53 (cat. no. RC200003), IMPDH2 (cat. no. RC202977), AGK (cat. no. RC201891), PARP1 (cat. no. RC207085), DGKE (cat. no. RC219913)
A Proteogenomic Atlas of Clear Cell Renal Cell Carcinoma in a Chinese Population
Ding, Qu, Feng et al
Research Square (2021)
Ding, Qu, Feng et al
Research Square (2021)
Multiple biochemical properties of the p53 molecule contribute to activation of polymerase iota-dependent DNA damage tolerance
Biber, Pospiech, Gottifredi et al
Nucleic Acids Res (2020) 48 (21), 12188-12203 DOI: 10.1093/nar/gkaa974
Biber, Pospiech, Gottifredi et al
Nucleic Acids Res (2020) 48 (21), 12188-12203 DOI: 10.1093/nar/gkaa974
Cited by 25
AI Summary: OriGene’s p53 (Myc-DDK tagged) expression plasmid (ORF plasmid RC200003) was used as the template for generating specific p53 mutants, enabling the study of how distinct biochemical properties of p53 contribute to polymerase iota-dependent DNA damage tolerance.
Snippet: pression plasmids for expression of the p53 variants having lost aa 1–79, aa 327–342 and aa 370–393, respectively. pCMV-p53(48H/49H) were commercially cloned by Amsbio to mutate the ORF plasmid RC200003 for expression of human p53 (Myc-DDK tagged) with aa exchanges D48H (nucleotide sequence GAC to CAC) and D49H (nucleotide sequence GAT to CAT) which were previously described to disrupt RPA-b
AXL Inactivation Inhibits Mesothelioma Growth and Migration via Regulation of p53 Expression
Song, Wang, Lu et al
Cancers (Basel) (2020) 12 (10) DOI: 10.3390/cancers12102757
Song, Wang, Lu et al
Cancers (Basel) (2020) 12 (10) DOI: 10.3390/cancers12102757
Cited by 21
AI Summary: OriGene's AXL and p53 expression plasmids were used in this study to investigate how manipulating AXL and p53 levels affects mesothelioma cell growth, migration, and the regulatory feedback between AXL and p53.
Snippet: … Our previous reports implicate AXL overexpression, activation, and regulation of downstream intermediates including PI3K/AKT/mTOR and RAF/MAPK in mesothelioma tumorigenesis [11,12]. AXL also has tumorigenic roles in carcinomas. For example, AXL regulation of miR-374a and miR-548b conferred drug resistance to EGFR inhibitors such as gefitinib in non-small cell;The Bio-Rad iScriptTM cDNA synthesis Kit and iQ SYBR green supermix were obtained from Bio-Rad Laboratories (Hercules, CA, USA). Lentiviral shRNA constructs were from The RNAi Consortium (TRC, Cambridge, MA, USA), and included AXL: GCTGTGAAGACGATGAAGATT;and p53: CTTCGACTATCTCAAACTCCT. AXL and p53 expression plasmid was purchased from Origene Technologies, Inc. … The luciferase reporters of luc-p53 (−2.4 kb) promoter has been described previously [40,41]. …
The endoplasmic reticulum acetyltransferases ATase1/NAT8B and ATase2/NAT8 are differentially regulated to adjust engagement of the secretory pathway
Rigby, Ding, Farrugia et al
J. Neurochem. (2020)
Rigby, Ding, Farrugia et al
J. Neurochem. (2020)
Cited by 16
AI Summary: OriGene products—including the anti-DDK antibody (TA50011), pCMV6-entry plasmid backbone (PS100001), and expression plasmids for human NAT8B (RC215647), NAT8 (RC203157), CREB1 (RC210577), c-FOS (RC202597), c-JUN (RC209804), and p53 (RC200003)—were used for protein detection and gene overexpression experiments that enabled the study of regulatory mechanisms controlling ATase1/NAT8B and ATase2/NAT8 in the secretory pathway.
Snippet: lysine (Abcam #ab409;RRID:AB_308707), anti-DDK (Origene TA50011;RRID:AB_2622345), and anti-Myc (Santa Cruz Biotechnology sc-40;RRID:AB_627268) (pCMV6-entry backbone;OriGene #PS100001;2017) or empty plasmid (serving as a control). … pCMV6-entry empty plasmid (OriGene, #PS100001;2017);cells were harvested 48 hr after transfection. PC12 stable lines were generated by transfecting with Lipofectamine 2000 using the following plasmids: pCMV6-entry empty plasmid (described above), human NAT8B-pCMV6 (OriGene, #RC215647;2018), or human NAT8-pCMV6 (OriGene, #RC203157;2018)...DDK (Origene, TA50011;RRID:AB_2622345)...transcription factor expression plasmid (pCMV6-entry backbone;OriGene, #PS100001;2017)...human CREB1-pCMV6 (Origene, #RC210577;2017), human c-FOS-pCMV6 (Origene, #RC202597;2017), human c-JUN-pCMV6 (Origene, #RC209804;2017), p53-pCMV6 (OriGene, #RC200003;2019)
High-resolution protein-protein interaction mapping using all-versus-all sequencing (AVA-Seq)
Andrews, Schaefer-Ramadan, Al-Thani et al
J Biol Chem (2019) 294 (30), 11549-11558 DOI: 10.1074/jbc.RA119.008792
Andrews, Schaefer-Ramadan, Al-Thani et al
J Biol Chem (2019) 294 (30), 11549-11558 DOI: 10.1074/jbc.RA119.008792
AI Summary: OriGene contributed to this study by providing six human gene clones (PKAR2 [RC220376], AKAP5 [RC221314], MDM2 [RC219518], p53 [RC200003], FOS [RC202597], and JUN [RC209804] in pCMV6-Entry vectors), which were used as source material for protein-protein interaction mapping in the AVA-Seq system.
Snippet: … Despite their success;The following six human genes were purchased from Origene as 10-μg stocks in pCMV6-Entry vector with SgfI and MluI cloning sites: PKAR2 (RC220376;1212 bp), AKAP5 (RC221314;1281 bp), MDM2 (RC219518;1491 bp), p53 (RC200003;1179 bp), FOS (RC202597;1140 bp), and JUN (RC209804;993 bp). …
Showing 1-6 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
