TrueORF® cDNA Clones: Ready-to-Use Tagged cDNA Clones

TrueORF cDNA clones are tagged ORF clones in mammalian expression vectors

  • Genome wide coverage for human, mouse and rat
  • Two types of tags: Myc-DDK tagged or GFP tagged
  • New: Lenti options are now available.
  • 20,000 Human clones are validated for protein expression
  • 70 destination vectors for additional applications
  • Clone collections available

10,000 ORF clones at $98 each

Get 20% off when you buy 2 or more on any of our non-viral cDNA clones

Custom lentivirus production services

Need>10 cloned? Request a Quote
Lentivirus efficient gene delivery tool

The same ORF inserts are available in 4 different expression vectors

  pCMV6-Entry pCMV6-AC-GFP pLenti-C-Myc-DDK pLenti-C-mGFP
Vector SKU PS100001 PS100010 PS100064 PS100071
Vector Map pCMV6 Entry Vector Map pCMV6-AC-GFP Vector Map pLenti-C-Myc-DDK Vector Map pLenti-C-mGFP Vector Map
Fusion Tag C-terminal Myc-DDK C-terminal tGFP C-terminal Myc-DDK C-terminal mGFP
Ideal For Detection and pufirication of over-expressed protein Tracking the over-expressed protein in tranfected cells In hard-to-transfect cells: Detection and purification of over-expressed protein Tracking the over-expressed protein in tranfected cells

Technical features of TrueORF:

  • The CMV promoter and a Kozak consensus sequence drive protein expression in mammalian cells.
  • The C-terminus of the ORF is tagged with Myc/DDK* or tGFP.
  • Ten (10) ug of purified plasmid is provided for immediate transfection and expression experiments.
  • The upstream T7 promoter allows protein expression in cell-free system.
  • Engineered as the entry vector for the OriGene PrecisionShuttle system.

Each TrueORF Clone is provided with a pair of sequencing primers:

Primer name Primer sequence (for sequencing)
VP1.5 (forward) 5' GGACTTTCCAAAATGTCG 3'
XL39 (reverse) 5' ATTAGGACAAGGCTGGTGGG 3'

View Location on Vectors

* Peptide sequence of the DDK-tag (Flag®): N-DYKDDDDK-C Flag® is a registered trademark of Sigma-Aldrich