CDH1 Human Gene Knockout Kit (CRISPR)

CAT#: KN220731

CDH1 - human gene knockout kit via CRISPR, HDR mediated

change donor?

 HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol CDH1
Locus ID 999
Kit Components

KN220731G1, CDH1 gRNA vector 1 in pCas-Guide vector, Target Sequence: GAATGCGTCCCTCGCAAGTC

KN220731G2, CDH1 gRNA vector 2 in pCas-Guide vector, Target Sequence: CCGAGAGGCTGCGGCTCCAA

KN220731-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001317184, NM_001317185, NM_001317186, NM_004360, XM_011523488, XM_011523489
Synonyms Arc-1; BCDS1; CD324; CDHE; ECAD; LCAM; UVO
Summary This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
