pCas-Guide

Snippet: sgRNAs were cloned into a pCasGuide plasmid (Origene, Vento, Netherlands;#SKU GE100002) and cotransfected with donor-carrying pUC into wild-type MCF-7 using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA;L3000008)

Snippet: … Applying CRISPR-Cas9 to obtain ΔCaprin-1 cell line U2OS-WT (ATCC Cat# HTB-96, RRID:CVCL_0042) cells were plated and transfected with the pCas9-Guide (Origene GE100002, electronic supplementary material, table S3) constructs using Lipofectamine 2000 overnight, allowed to recover for greater than or equal to 2 days, and thereafter were reseeded and s;- U2OS-WT (ATCC Cat# HTB-96, RRID:CVCL_0042) cells were plated and transfected with the pCas9-Guide (Origene GE100002, electronic supplementary material, table

Snippet: Plasmid guide RNA (gRNA) Cas9 constructs based on the vector GE100002 and donor 100-basepair (bp) single-stranded DNA (ssDNA) oligonucleotides (oligos) (Origene, Herford, Germany) were designed to introduce CYP24A1 3′ UTR alterations (File S1)

Snippet: s of exon 3 of Mstn with CRISPR/Cas9 system, as described previously [67], produced MSTN-deficient mice. The sgRNA sequence (TATAAGGCCAATTACTGCTCAGG) was cloned into the PCas9-Guide vector (GE100002, Origene, China). … Targeted mutations of exon 3 of Mstn with CRISPR/Cas9 system, as described previously [67], produced MSTN-deficient mice. The sgRNA sequence (TATAAGGCCAATTACTGCTCAGG) was cloned into the PCas9-Guide vector (GE100002, Origene, China)

Snippet: DIA3 gene. Oligonucleotides (5′-GATCGTGTCAGCCACTTGAAGAAGC-3′, 3′-AAAACGCTTCTTCAAGTGGCTGACA-5′) were annealed and directionally cloned with BamHI and BsmBI into a pCas-Guide plasmid (Ge100002, Origene) encoding Cas9 downstream of a CMV promoter. Genotyping was performed by standard PCR using primers flanking the predicted cut site (5′-GATCGGGTAACGAGTTGGTCCCGC-3′, 3′-AAAACGTAGGCCCAACAG