TP53 Human Gene Knockout Kit (CRISPR)

CAT#: KN200003

TP53 - human gene knockout kit via CRISPR

change donor?

USD 1,290.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Symbol TP53
Locus ID 7157
Kit Components

KN200003G1, TP53 gRNA vector 1 in pCas-Guide vector, Target Sequence: TCGACGCTAGGATCTGACTG

KN200003G2, TP53 gRNA vector 2 in pCas-Guide vector, Target Sequence: CTGTGAGTGGATCCATTGGA

KN200003-D, donor vector containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet

GGAGGCTGAGGCGGGCCGATCACCTGAAGTAAGGAGTTCGAGACCAGCCTGGCCAACATGCAAAGCCCTGTCTCTACTAAAAATACAAAAATTAGCTGGGTGTGGTGGTACTCGCCTGTAATCCCAGCTACTCGGGAGACTGAGGCAGGAGAATGGCTTGAACCCGGAAGGTAGAGGTTGCAGTGAGCTGAGATCATGCCACTGTGCTCCAGCCTAGGTGACAGAGAGAGACTCCATCTCAAAAAAAAAAAAAAAATACAGGAAGGGAGTTGGGAATAGGGTGCACATTTAGGAAGTCTTGGGGATTTAGTGGTGGGAAGGTTGGAAGTCCCTCTCTGATTGTCTTTTCCTCAAAGAAGTGCATGGCTGGTGAGGGGTGGGGCAGGAGTGCTTGGGTTGTGGTGAAACATTGGAAGAGAGAATGTGAAGCAGCCATTCTTTTCCTGCTCCACAGGAAGCCGAGCTGTCTCAGACACTGGCATGGTGTTGGGGGAGGGGGTTCCTTCTCTGCAGGCCCAGGTGACCCAGGGTTGGAAGTGTCTCATGCTGGATCCCCACTTTTCCTCTTGCAGCAGCCAGACTGCCTTCCGGGTCACTGCCGCAGAGACCTGTGGGAAGCGAAAATTCCATGGGACTGACTTTCTGCTCTTGTCTTTCAGACTTCCTGAAAACAACGTTCTGGTAAGGACAAGGGTTGGGCTGGGGACCTGGAGGGCTGGGGACCTGGAGGGCTGGGGGGCTGGGGGGCTGAGGACCTGGTCCTCTGACTGCTCTTTTCACCCATCTACAGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGGTCAGTTGCCCTGAGGGGCTGGCTTCCATGAGACTTCAATGCCTGGCCGTATCCCCCTGCATTTCTTTTGTTTGGAACTTTGGGATTCCTCTTCACCCTTTGGCTTCCTGTCAGTGTTTTTTTATAGTTTA

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000546, NM_001126112, NM_001126113, NM_001126114, NM_001126115, NM_001126116, NM_001126117, NM_001126118, NM_001276695, NM_001276696, NM_001276697, NM_001276698, NM_001276699, NM_001276760, NM_001276761
Synonyms BCC7; LFS1; P53; TRP53
Summary This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents