OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCas-Guide-AAVS1

Be the first to review this product
SKU
GE100023
AAVS1 gRNA vector, validated AAVS1 targeting sequence cloned in pCas-Guide vector
  $670.00
In Stock*

Frequently Bought Together (4)

TA811179 CAS9 mouse monoclonal antibody,clone OTI5E5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TP790148 Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E.coli, sterile-filtered, suitable for cell culture
500 pmol
$150.00
TP790151 Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
500 pmol
$160.00
Specifications
Specifications
Product Data
Function All-in-One CRISPR/Cas9 vectors
Features
  • Validated CRISPR vector targeting human AAVS1 site
  • AAVS1 target sequence: GTTAATGTGGCTCTGGTTCT
  • CMV-driven Cas9 and U6-driven AAVS1 gRNA expression

Applications

  • Targeted transgene insertion via CRISPR when cotransfected with pAAVS1-puro-DNR (after transgene cloned)
  • CRISPR knockin positive control when paired with pAAVS1-RFP-DNR (SKU GE100026)
Download Vector Sequence
Storage Please store at -20°C for long term storage.
Stability The dried and the suspended DNA are stable for one year from date of shipping when stored at -20°C.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Efficient Fluorescent Labeling of Human Trophoblast Stem Cells via a CRISPR/Cas9-Mediated Knock-In Approach in a Safe Harbor Locus
Zhang, Zhou, Orsolini et al
Bio Protoc (2026) 16 (1), e5561 DOI: 10.21769/BioProtoc.5561
AI Summary: OriGene contributed to this study by providing the pCas-Guide-AAVS1 all-in-one AAVS1 gRNA plasmid (catalog number: GE100023), which was used for CRISPR/Cas9-mediated targeting of the AAVS1 safe harbor locus to efficiently label human trophoblast stem cells with GFP.
Snippet: l line were between 19 and 25, and mycoplasma testing was performed periodically. 2. pCas-Guide-AAVS1, an all-in-one AAVS1 gRNA plasmid, delivered as a lyophilized 10 μg product (Origene, catalog number: GE100023)3. pAAVS1-P-CAG-GFP, a donor plasmi
FigureFigureFigure
Methionine sulfoxide reductase B2 protects against cardiac complications in diabetes mellitus
Lee, Cho, Lee et al
Diabetol Metab Syndr (2024) 16 (1), 149 DOI: 10.1186/s13098-024-01390-0
Cited by 2
AI Summary: OriGene’s Parkin and MsrB2 ORF clones were used in this study to generate RFP- and GFP-tagged fusion proteins, enabling the investigation of their roles in mitophagy and cardiac protection in diabetic cardiomyopathy.
Snippet: We purchased Parkin and MsrB2 ORF clones from OriGene (USA) and subcloned them into RFP- and GFP-tagged vectors, respectively. Cherry-LC3 was purchased by;cytes were cultured in a serum-free medium for ≥ 4 h and treated with 100 ng Endothelin-1 (ET-1) or 25 mM glucose for 48 h. Transient transfection We purchased Parkin and MsrB2 ORF clones from OriGene (USA) and subcloned them into RFP- and GFP...
FigureFigureFigure
Enhancing Peptide and PMO Delivery to Mouse Airway Epithelia by Chemical Conjugation with the Amphiphilic Peptide S10
Auger, Sorroza-Martinez, Brahiti et al
Molecular Therapy - Nucleic Acids (2024)
Cited by 2
AI Summary: OriGene products, specifically the AAVS1 targeting vectors (CAT#: GE100023 and customized GE100024), were used to introduce an EGFP reporter cassette and selection marker into cells, enabling the generation and validation of modified cell lines for the study.
Snippet: resistant gene, an EGFP544 654 reporter cassette, and a homology arms to the AAVS1 locus sequence (OriGene 545 Technologies, CAT#: GE100023 and customized GE100024). Cells were selected for 546 puromycin resistance and single clones were isolated, validated, and used for in
Multiple mechanisms activate GCN2 eIF2 kinase in response to diverse stress conditions
Misra, Carlson, Spandau et al
Nucleic Acids Res (2024) 52 (4), 1830-1846 DOI: 10.1093/nar/gkae006
Cited by 63
AI Summary: OriGene products pCas-Guide-AAVS1 (Cat #GE100023) and pAAVS1EF1a-Puro-DNR (Cat #GE100046) plasmids were used for plasmid constructions in the study investigating mechanisms of GCN2 activation under stress conditions.
Snippet: Plasmid constructions The pCas-Guide-AAVS1(Cat #GE100023) and pAAVS1EF1a-Puro-DNR (Cat #GE100046) plasmids were obtained from Origene. A segment of
A Novel Role for ACE2-TMEM16 Complexes in SARS-CoV-2 Infection
Vidmar
Thesis (2024)
Snippet: U2OS and Vero cell lines stably expressing ACE2-eGFP were obtained through the Transgene Knockin via CRISPR at AAVS1 and ROSA26 Loci Kit (GE100027 Origene). We used ACE2eGFP (154962 AddGene) for the insert, while the pAAVS1-Puro-DNR (GE100024) was the donor. … Once obtained the plasmid through cloning, we followed the manufacturer’s instruction transfecting 1ug of donor and 1ug of GE100023 pCas-Guide-AAVS1 diluting them in Opti-MEM (Life Technologies), m
Comparison of different gene addition strategies to modify placental derived-mesenchymal stromal cells to produce FVIII
Ramamurthy, Rodriguez, Ainsworth et al
Front Immunol (2022) 13, 954984 DOI: 10.3389/fimmu.2022.954984
Cited by 4
AI Summary: OriGene products, specifically the pCas-Guide-AAVS1 (GE100023) and pAAVS1-puro-DNR (GE100024) plasmids, were used as key tools for CRISPR/Cas9-mediated insertion attempts of the fVIII transgene into the AAVS1 genomic safe harbor in this study.
Snippet: ator with 5% CO2. Plasmid construction and synthesis An AAVS1 transgene knock-in vector kit, consisting of the pCas-Guide-AAVS1 (GE100023) and pAAVS1-puro-DNR (GE100024) plasmids, was purchased from OriGene Technologies, Inc. (Rockville, MD). A “cassette” containing the bioengineered fVIII transgene “lcoET3” under the transcriptional control of the constitutively active human EF1α promot
FigureFigureFigure
Showing 1-6 of 13 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products