OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

APC Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN211629BN
APC - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA803655 APC mouse monoclonal antibody, clone OTI2B8 (formerly 2B8) 100 ul
$447.00
RC226492 APC (Myc-DDK-tagged)-Human adenomatous polyposis coli (APC), transcript variant 1
10 ug
$3,455.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "APC or NM_000038"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol APC
Locus ID 324
Components

KN211629G1, APC gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCGACCGGACCCGAGCCCA

KN211629G2, APC gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGTGGTACAGAAGCGGGCAA

KN211629BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000038, NM_001127510, NM_001127511, NM_001354895, NM_001354896, NM_001354897, NM_001354898, NM_001354899, NM_001354900, NM_001354901, NM_001354902, NM_001354903, NM_001354904, NM_001354905, NM_001354906
UniProt ID P25054
Synonyms BTPS2; DP2; DP2.5; DP3; GS; PPP1R46
Summary This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. provided by RefSeq, Dec 2019
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA100225 APC CRISPRa kit - CRISPR gene activation of human APC regulator of WNT signaling pathway 1 kit
$1,657.00
KN211629 APC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN211629LP APC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN211629RB APC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN411629 APC - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products