AXL Human Gene Knockout Kit (CRISPR)

CAT#: KN206431

AXL - human gene knockout kit via CRISPR, HDR mediated

Product Images

Specifications

Product Data

• Format: 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
• Donor DNA: GFP-puro
• Symbol: AXL
• Locus ID: 558
• Components:

  KN206431G1, AXL gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTGCTTGGCGCTGTGCGGCT

  KN206431G2, AXL gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGGCGTGCATGGCCCCCAG

  KN206431D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

  GE100003, scramble sequence in pCas-Guide vector

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data

• RefSeq: NM_001278599, NM_001699, NM_021913
• UniProt ID: P30530
• Synonyms: ARK; JTK11; Tyro7; UFO
• Summary: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]