HDAC3 Human Gene Knockout Kit (CRISPR)

CAT#: KN200605

Reviews ()
Write a review

HDAC3 - human gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,657.00

4 Weeks*

Size
    • 1 kit

Product images

Other products for "HDAC3"

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol HDAC3
Locus ID 8841
Kit Components

KN200605G1, HDAC3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTATTTCTACGACCCCGACG

KN200605G2, HDAC3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGCAACTTCCACTACGGTG

KN200605-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet

GATCGTTGGG AACCGGAGCT GAATGAAGCC ATACCAAACG ACGAGCGTGA CACCACGATG CCTGTAGCAA TGGCAACAAC GTTGCGCAAA CTATTAACTG GCGAACTACT TACTCTAGCT TCCCGGCAAC AATTAATAGA CTGGATGGAG GCGGATAAAG TTGCAGGACC ACTTCTGCGC TCGGCCCTTC CGGCTGGCTG GTTTATTGCT GATAAATCTG GAGCCGGTGA GCGTGGTTCT CGCGGTATCA TTGCAGCACT GGGGCCAGAT GGTAAGCCCT CCCGTATCGT AGTTATCTAC ACGACGGGGA GTCAGGCAAC TATGGATGAA CGAAATAGAC AGATCGCTGA GATAGGTGCC TCACTGATTA AGCATTGGTA ACTGTCAGAC CAAGTTTACT CATATATACT TTAGATTGAT TTAAAACTTC ATTTTTAATT TAAAAGGATC TAGGTGAAGA TCCTTTTTGA TAATCTCATG ACCAAAATCC CTTAACGTGA GTTTTCGTTC CACTGAGCGT CAGACCCCGT AGAAAAGATC AAAGGATCTT CTTGAGATCC TTTTTTTCTG CGCGTAATCT GCTGCTTGCA AACAAAAAAA CCACCGCTAC CAGCGGTGGT TTGTTTGCCG GATCAAGAGC TACCAACTCT TTTTCCGAAG GTAACTGGCT TCAGCAGAGC GCAGATACCA AATACTGTTC TTCTAGTGTA GCCGTAGTTA GGCCACCACT TCAAGAACTC TGTAGCACCG CCTACATACC TCGCTCTGCT AATCCTGTTA CCAGTGGCTG CTGCCAGTGG CGATAAGTCG TGTCTTACCG GGTTGGACTC AAGACGATAG TTACCGGATA AGGCGCAGCG GTCGGGCTGA ACGGGGGGTT CGTGCACACA GCCCAGCTTG GAGCGAACGA CCTACACCGA ACTGAGATAC CTACAGCGTG AGCTATGAGA AAGCGCCACG CTTCCCGAAG GGAGAAAGGC GGACAGGTAT CCGGTAAGCG GCAGGGTCGG AACAGGAGAG CGCACGAGGG AGCTTCCAGG GGGAAACGCC TGGTATCTTT ATAGTCCTGT CGGGTTTCGC CACCTCTGAC TTGAGCGTCG ATTTTTGTGA TGCTCGTCAG GGGGGCGGAG CCTATGGAAA AACGCCAGCA ACGCGGCCTT TTTACGGTTC CTGGCCTTTT GCTGGCCTTT TGCTCACATG TTCTTTCCTG CGTTATCCCC TGATTCTGTG GATAACCGTA TTACCGCCTT TGAGTGAGCT GATACCGCTC GCCGCAGCCG AACGACCGAG CGCAGCGAGT CAGTGAGCGA GGAAGCGGAA GAGCGCCCAA TACGCAAACC GCCTCTCCCC GCGCGTTGGC CGATTCATTA ATGCAGCTGG CACGACAGGT TTCCCGACTG GAAAGCGGGC AGTGAGCGCA ACGCAATTAA TGTGAGTTAG CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC CGGCTCGTAT GTTGTGTGGA ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG ACCATGATTA CGCCAAGCTC CTTCCTCTTC CAGCCCTTCC TCTTTCACTG ACTGACTGAT TGCGTCTCAA CCTAGCTCTG CGCGCGCGTG ACTGCGCCGG GCCCCCCCGG GGCAATGTGC GGCGCCGAGT CTGGGTCCGG GTAGGGGACA GGCGGTCCGG CGTGGGTGTT GTCCACTGGT CTATCCGGTA CGCCTGGCGC AGCTCCTGCC CTCAGATGCC CCGACCGAGC GGAGAGTCAG GAATCTTCTC CGAGGGCTGG GGGAAGCCGG CTTTCCGCAC CTTTGAGGGA CGGAGTGGCG GGATCTTCGG AGCTTCCTAG AGAAGTGACC ACGGCCTGCG CCCGGTTTGG GGCAAGCGGC TGGATGGGAT GGCTCGGCTT CCCGAGGATC TGACCCCCGG CCGGAGACAA ATGGCCCTCG CATCCTAGGA GCTATGCTGC CAGTTCCCTG CCCAACCCGG GACGCTCAAA GCCCCAGATA CCGGGAGAGC TGAGCCGGGC GAGGGGCGGA GCTCCCCTGG GGGCGTGGCC TGGGTGTGGA TGGAGGCGGG GCCGCAACGC CCAGTTCCGC AGAGGCCGGC TACGTGCTTG CGCAGCACGC ACGGCCGGGG AGGGGCTGGC GGCGGCCGCG GGCGGCGGGC GGCGGAGGTG CGGGGCCTGC TCCCGCCGGC ACCACTAGCA TGGAGAGCGA CGAGAGCGGC CTGCCCGCCA TGGAGATCGA GTGCCGCATC ACCGGCACCC TGAACGGCGT GGAGTTCGAG CTGGTGGGCG GCGGAGAGGG CACCCCCGAG CAGGGCCGCA TGACCAACAA GATGAAGAGC ACCAAAGGCG CCCTGACCTT CAGCCCCTAC CTGCTGAGCC ACGTGATGGG CTACGGCTTC TACCACTTCG GCACCTACCC CAGCGGCTAC GAGAACCCCT TCCTGCACGC CATCAACAAC GGCGGCTACA CCAACACCCG CATCGAGAAG TACGAGGACG GCGGCGTGCT GCACGTGAGC TTCAGCTACC GCTACGAGGC CGGCCGCGTG ATCGGCGACT TCAAGGTGAT GGGCACCGGC TTCCCCGAGG ACAGCGTGAT CTTCACCGAC AAGATCATCC GCAGCAACGC CACCGTGGAG CACCTGCACC CCATGGGCGA TAACGATCTG GATGGCAGCT TCACCCGCAC CTTCAGCCTG CGCGACGGCG GCTACTACAG CTCCGTGGTG GACAGCCACA TGCACTTCAA GAGCGCCATC CACCCCAGCA TCCTGCAGAA CGGGGGCCCC ATGTTCGCCT TCCGCCGCGT GGAGGAGGAT CACAGCAACA CCGAGCTGGG CATCGTGGAG TACCAGCACG CCTTCAAGAC CCCGGATGCA GATGCCGGTG AAGAAAGAGT TTAAGAATTC CGATCATATT CAATAACCCT TAATATAACT TCGTATAATG TATGCTATAC GAAGTTATTA GGTCTGAAGA GGAGTTTACG TCCAGCCAAG CTTAGGATCT CGACCTCGAA ATTCTACCGG GTAGGGGAGG CGCTTTTCCC AAGGCAGTCT GGAGCATGCG CTTTAGCAGC CCCGCTGGGC ACTTGGCGCT ACACAAGTGG CCTCTGGCCT CGCACACATT CCACATCCAC CGGTAGGCGC CAACCGACTC CGTTCTTTGG TGGCCCCTTC GCGCCACCTT CTACTCCTCC CCTAGTCAGG AAGTTCCCCC CCGCCCCGCA GCTCGCGTCG TGCAGGACGT GACAAATGGA AGTAGCACGT CTCACTAGTC TCGTGCAGAT GGACAGCACC GCTGAGCAAT GGAAGCGGGT AGGCCTTTGG GGCAGCGGCC AATAGCAGCT TTGCTCCTTC GCTTTCTGGG CTCAGAGGCT GGGAAGGGGT GGGTCCGGGG GCGGGCTCAG GGGCGGGCTC AGGGGCGGGG CGGGCGCCCG AAGGTCCTCC GGAGGCCCGG CATTCTGCAC GCTTCAAAAG CGCACGTCTG CCGCGCTGTT CTCCTCTTCC TCATCTCCGG GCCTTTCGAC CTGCATCCAT CTAGATCTCG AGCAGCTGAA GCTTACCATG ACCGAGTACA AGCCCACGGT GCGCCTCGCC ACCCGCGACG ACGTCCCCAG GGCCGTACGC ACCCTCGCCG CCGCGTTCGC CGACTACCCC GCCACGCGCC ACACCGTCGA TCCGGACCGC CACATCGAGC GGGTCACCGA GCTGCAAGAA CTCTTCCTCA CGCGCGTCGG GCTCGACATC GGCAAGGTGT GGGTCGCGGA CGACGGCGCC GCGGTGGCGG TCTGGACCAC GCCGGAGAGC GTCGAAGCGG GGGCGGTGTT CGCCGAGATC GGCCCGCGCA TGGCCGAGTT GAGCGGTTCC CGGCTGGCCG CGCAGCAACA GATGGAAGGC CTCCTGGCGC CGCACCGGCC CAAGGAGCCC GCGTGGTTCC TGGCCACCGT CGGCGTCTCG CCCGACCACC AGGGCAAGGG TCTGGGCAGC GCCGTCGTGC TCCCCGGAGT GGAGGCGGCC GAGCGCGCCG GGGTGCCCGC CTTCCTGGAG ACCTCCGCGC CCCACAACCT CCCCTTCTAC GAGCGGCTCG GCTTCACCGT CACCGCCGAC GTCGAGGTGC CCGAAGGACC GCGCACCTGG TGCATGACCC GCAAGCCCGG TGCCTGACGC CCGCCCCACG ACCCGCAGCG CCCGACCGAA AGGAGCGCAC GACCCCATGC ATCGATGATA TCAGATCCCC GGGATGCAGA AATTGATGAT CTATTAAACA ATAAAGATGT CCACTAAAAT GGAAGTTTTT CCTGTCATAC TTTGTTAAGA AGGGTGAGAA CAGAGTACCT ACATTTTGAA TGGAAGGATT GGAGCTACGG GGGTGGGGGT GGGGTGGGAT TAGATAAATG CCTGCTCTTT ACTGAAGGCT CTTTACTATT GCTTTATGAT AATGTTTCAT AGTTGGATAT CATAATTTAA ACAAGCAAAA CCAAATTAAG GGCCAGCTCA TTCCTCCCAC TCATGATCTA TAGATCTATA GATCTCTCGT GGGATCATTG TTTTTCTCTT GATTCCCACT TTGTGGTTCT AAGTACTGTG GTTTCCAAAT GTGTCAGTTT CATAGCCTGA AGAACGAGAT CAGCAGCCTC TGTTCCACAT ACACTTCATT CTCAGTATTG TTTTGCCAAG TTCTAATTCC ATCAGAAGCT GGTCGAGATC CGGAACCCTT AATATAACTT CGTATAATGT ATGCTATACG AAGTTATTAG GTCCCTCGAA GAGGTTCACT AGGCGCGCCA CTCCAGGGGT GAGAGCTGAC GAACTCTCTT CTCCCCACCC CCAGGAGCTG GACACCCTAT GAAGCCCCAT CGCCTGGCAT TGACCCATAG CCTGGTCCTG CATTACGGTC TCTATAAGAA GATGATCGTG AGTTCCGCCG CCTCGGCCGG GGGTTGGGGG GTGGGGCGAG CTGTGGCCGT AGGGATAGGT GGGCTGGACT GAGTGCATGA AGTGCGACCC GCCCCTAGAG TATCGGGGAG CTGGATAGAA GTCACCAGGA GTACCTTGAA AGTGCAGGGT GTTGGGGGTG GCGTCCTCTG CTTAATGGAA AGTACTTTCT CACCTCAGGT CGGCCACCCT CTGACTGTAG GCACACTAGC CCTTGGCCTA GGGTTAGCGT GATGTGGGGC TGGTTTGAAG ACAGAAGGTG TGTTCCTCCT CTGCATTTTA GAGTGTGGAT AGGGCCTTGG CCTCAGGAAT TAGGGTTAGG GGAGCGGATA TCACTGTATC AGGGTGTGAG GTTTACCCTC AGTTCCCACT CCTCTTTTAC CACCTTTCTT TACCTCCAAG GAGCTAGGGC TCCAGGGTGG AACGATGCTG CCGTCTTTGT AAATGTGTAA CGAAGAGACG ACTGACTGAC TGACTGGAAA GTCCTCTCCA CTGACTGTAG CCTCCAATTC ACTGGCCGTC GTTTTACAAC GTCGTGACTG GGAAAACCCT GGCGTTACCC AACTTAATCG CCTTGCAGCA CATCCCCCTT TCGCCAGCTG GCGTAATAGC GAAGAGGCCC GCACCGATCG CCCTTCCCAA CAGTTGCGCA GCCTGAATGG CGAATGGCGC CTGATGCGGT ATTTTCTCCT TACGCATCTG TGCGGTATTT CACACCGCAT ACGTCAAAGC AACCATAGTA CGCGCCCTGT AGCGGCGCAT TAAGCGCGGC GGGTGTGGTG GTTACGCGCA GCGTGACCGC TACACTTGCC AGCGCCCTAG CGCCCGCTCC TTTCGCTTTC TTCCCTTCCT TTCTCGCCAC GTTCGCCGGC TTTCCCCGTC AAGCTCTAAA TCGGGGGCTC CCTTTAGGGT TCCGATTTAG TGCTTTACGG CACCTCGACC CCAAAAAACT TGATTTGGGT GATGGTTCAC GTAGTGGGCC ATCGCCCTGA TAGACGGTTT TTCGCCCTTT GACGTTGGAG TCCACGTTCT TTAATAGTGG ACTCTTGTTC CAAACTGGAA CAACACTCAA CCCTATCTCG GGCTATTCTT TTGATTTATA AGGGATTTTG CCGATTTCGG CCTATTGGTT AAAAAATGAG CTGATTTAAC AAAAATTTAA CGCGAATTTT AACAAAATAT TAACGTTTAC AATTTTATGG TGCACTCTCA GTACAATCTG CTCTGATGCC GCATAGTTAA GCCAGCCCCG ACACCCGCCA ACACCCGCTG ACGCGCCCTG ACGGGCTTGT CTGCTCCCGG CATCCGCTTA CAGACAAGCT GTGACCGTCA ACGGGAGCTG CATGTGTCAG AGGTTTTCAC CGTCATCACC GAAACGCGCG ACCCGAAAGG GCCTCGTGAT ACGCCTATTT TTATAGGTTA ATGTCATGAT AATAATGGTT TCTTAGACGT CAGGTGGCAC TTTTCGGGGA AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA AAAGGAAGAG TATGAGTATT CAACATTTCC GTGTCGCCCT TATTCCCTTT TTTGCGGCAT TTTGCCTTCC TGTTTTTGCT CACCCAGAAA CGCTGGTGAA AGTAAAAGAT GCTGAAGATC AGTTGGGTGC ACGAGTGGGT TACATCGAAC TGGATCTCAA CAGCGGTAAG ATCCTTGAGA GTTTTCGCCC CGAAGAACGT TTTCCAATGA TGAGCACTTT TAAAGTTCTG CTATGTGGCG CGGTATTATC CCGTATTGAC GCCGGGCAAG AGCAACTCGG TCGCCGCATA CACTATTCTC AGAATGACTT GGTTGAGTAC TCACCAGTCA CAGAAAAGCA TCTTACGGAT GGCATGACAG TAAGAGAATT ATGCAGTGCT GCCATAACCA TGAGTGATAA CACTGCGGCC AACTTACTTC TGACAACGAT CGGAGGACCG AAGGAGCTAA CCGCTTTTTT GCACAACATG GGGGATCATG TAACTCGCCT T

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_003883, NM_001355039, NM_001355040, NM_001355041, NR_149164, NR_149165, NR_149166, NR_149167, NR_149168, NR_149169
UniProt ID O15379
Synonyms HD3; RPD3; RPD3-2
Summary Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.