OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human RAB18 activation kit by CRISPRa

Be the first to review this product
SKU
GA107922
RAB18 CRISPRa kit - CRISPR gene activation of human RAB18, member RAS oncogene family
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

RC205505 RAB18 (Myc-DDK-tagged)-Human RAB18, member RAS oncogene family (RAB18)
10 ug
$300.00

Other products for "RAB18"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol RAB18
Locus ID 22931
Components

GA107922G1, RAB18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCCTCCCACTGACTCAAA

GA107922G2, RAB18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCTACCTCAAGGCGGAAC

GA107922G3, RAB18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTTTCACACCGGGTGTTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001256410, NM_001256411, NM_001256412, NM_001256415, NM_021252, NR_046172, N56901
UniProt ID Q9NP72
Synonyms RAB18LI1; WARBM3
Summary The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. provided by RefSeq, Jan 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN205505 RAB18 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN205505BN RAB18 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN205505LP RAB18 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN205505RB RAB18 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN405505 RAB18 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products