OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCas-Guide-GFP-CRISPRa gene activation vector

Be the first to review this product
SKU
GE100074
pCas-Guide-GFP-CRISPRa vector, All-in-one Vector for CRISPR/Cas9 Gene activation with tGFP reporter, dCas9-VP64 and gRNA cloning site.
  $670.00
In Stock*

Frequently Bought Together (4)

TA811179 CAS9 mouse monoclonal antibody,clone OTI5E5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TP790148 Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E.coli, sterile-filtered, suitable for cell culture
500 pmol
$150.00
TP790151 Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
500 pmol
$160.00
Specifications
Specifications
Product Data
Function All-in-one CRISPRa SAM vector
Features
  • BamH I and BsmB I can be used for genomic target sequence cloning
  • gRNA under U6 promoter
  • gRNA is modified with MS2 RNA aptamer in the loops
  • CMV driven dCas9-VP64, which can activate gene expression
  • For robust gene activation, needs to work with pCRISPRa-Enhancer
  • CF3 primer can be used to sequence target sequence after cloning
  • Contains tGFP reporter gene under EF1a promoter
Download Vector Sequence
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS.
Storage Please store at -20°C for long term storage.
Stability The dried and the suspended DNA are stable for one year from date of shipping when stored at -20°C.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

PRDM16-DT is a novel lncRNA that regulates astrocyte function in Alzheimer's disease
Schröder, Fuchs, Gisa et al
Acta Neuropathol (2024) 148 (1), 32 DOI: 10.1007/s00401-024-02787-x
Cited by 22
AI Summary: OriGene contributed to this study by providing the tGFP reporter gene (GE100074) and designing the gRNAs used for targeting Prdm16os.
Snippet: and a tGFP reporter gene were obtained from Origene (GE100074). The gRNAs for targeting Prdm16os were also designed by Origene and had the following sequences:
FigureFigureFigure
PRDM16-DT: A Brain and Astrocyte-Specific lncRNA Implicated in Alzheimer's Disease
Schröder, Fuchs, Gisa et al
bioRxiv (2024)
Cited by 4
Snippet: treated on DIV12 and all experiments were performed on DIV14. Prdm16os overexpression using CRISPRa Plasmids containing the guide RNA (gRNA), a dCas9-VP64 and a tGFP reporter gene were obtained from Origene (GE100074). The gRNAs for targeting Prdm16os were also designed by Origene and had the following sequences: gRNA-1: AGACGGTCACCTCGCCTCCA gRNA-2: GATAGTTGGGACACGGGTCC gRNA-3: GAGCCCGAAGCTGCA
FigureFigureFigure
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products