OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human KRAS activation kit by CRISPRa

Be the first to review this product
SKU
GA102608
KRAS CRISPRa kit - CRISPR gene activation of human KRAS proto-oncogene, GTPase
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA801672 KRAS mouse monoclonal antibody, clone OTI2C1 (formerly 2C1) 100 ul
$447.00
RC201958 KRAS (Myc-DDK-tagged)-Human v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), transcript variant b
10 ug
$289.00 $450.00

Other products for "KRAS"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol KRAS
Locus ID 3845
Components

GA102608G1, KRAS gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGACTTGGTTTTAGGCCCAA

GA102608G2, KRAS gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGCTGCATAAAAGATTCAC

GA102608G3, KRAS gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTATTCCATATCCATTTCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_004985, NM_033360, NM_001369786, NM_001369787
UniProt ID P01116
Synonyms C-K-RAS; c-Ki-ras2; CFC2; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS1; KRAS2; NS; NS3; RALD
Summary This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN201958 KRAS - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201958BN KRAS - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201958LP KRAS - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201958RB KRAS - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401958 KRAS - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products