OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pGuide-EF1a-GFP

Be the first to review this product
SKU
GE100044
pGuide-EF1a-GFP, gRNA only vector with EF1a driven GFP
  $670.00
In Stock*

Frequently Bought Together (4)

TA811179 CAS9 mouse monoclonal antibody,clone OTI5E5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TP790148 Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E.coli, sterile-filtered, suitable for cell culture
500 pmol
$150.00
TP790151 Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
500 pmol
$160.00
Specifications
Specifications
Product Data
Function gRNA only vectors
Features

gRNA only vector (Cas9 not present)

  • gRNA expression under U6 promoter
  • BamH I and BsmB I sites are used for target sequence cloning
  • Expresses gRNA containing the inserted target sequence and the gRNA scaffold
  • GFP as a reporter for tracking or sorting transfected cells
  • CF3 primer (GE100008) can be used to sequence the target sequence after cloning
Download Vector Sequence
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS.
Storage Please store at -20°C for long term storage.
Stability The dried and the suspended DNA are stable for one year from date of shipping when stored at -20°C.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

A homozygous nonsense variant in the oligosaccharyltransferase complex gene, RPN1, causes a congenital disorder of glycosylation
Ng, Zhang, Neil et al
HGG Adv (2026) 7 (3), 100604 DOI: 10.1016/j.xhgg.2026.100604
Cited by 2
AI Summary: In this study, OriGene’s pGuide-EF1a-GFP plasmid (GE100044) was used to introduce the RPN1 nonsense variant into HEK293 cells via CRISPR base-editing, enabling functional analysis of the mutation’s impact on glycosylation.
Snippet: "mmc1" ref-type="supplementary-material">Table S3.CRISPR base-editing HEK293 cellsHEK293 cells were co-transfected with pGuide-EF1a-GFP (OriGene GE100044) containing the guide RNA sequence 5′-AATGCAGAAGCTGGATGCA
Figure
A mutation in SLC37A4 causes a dominantly inherited congenital disorder of glycosylation characterized by liver dysfunction
Ng, Sosicka, Fenaille et al
Am J Hum Genet (2021) 108 (6), 1040-1052 DOI: 10.1016/j.ajhg.2021.04.013
Cited by 23
AI Summary: OriGene’s pGuide-EF1a-GFP (GE100044) plasmid was used to clone the guide RNA for CRISPR base-editing of the SLC37A4 gene, enabling the generation of a hepatoma cell line model to study the mutation’s effects in this paper.
Snippet: The guide RNA (gRNA) sequencing GATGGGCCGAGTGTCCAAGA targeting exon 10 of SLC37A4 was cloned into pGuide-EF1a-GFP (OriGene - GE100044)
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products