pGuide

Snippet: according to manufacturer’s instructions. GENERATION OF SITE-BASED MUTANT CELL LINES BY CRISPR-CAS9 GENE EDITING Mutant ESC cell lines were generated by cloning gRNAs into a U6 vector (GE100042, Origene) and co-transfection with a Cas9-expressing vector (GE100018, Origene) using Fugene6 (E2691, Roche) as described in [4]. Guide sequences are listed in [S2 Table]. RNA-SEQ LIBRARY PREPARATION

Snippet: Article.;Three sgRNA targets from the IL2RA genomic region and one control sequence from another chromosome were selected (sequences in Supplementary Table 2). These target sequences were cloned into Origene’s pGuide (GE100042) plasmid for construction of the sgRNA expression plasmids sgRNA1, sgRNA2, sgRNA3, and sgRNA control

Snippet: Briefly, a single guide RNA (sgRNA: ACAAAGTTGTCTTCTTCTAC) was cloned into a sgRNA vector using OriGene’s gRNA Cloning Services (Rockville, Maryland) and was then used as a template to synthesize sgRNAs sing the MEGAshortscript T7 Kit (Life Technologies)

Snippet: Cloning orientation was verified by sequencing. Plasmids ex- pressing miR-451a, miR-21-5p, and miR-7 and plasmid expressing only GFP were purchased from OriGene (Rockville, MD, USA). Plasmids expressing microRNAs also express GFP. ... Cite SaveSaving