pCas-Guide-EF1a-GFP

Snippet: according to manufacturer’s instructions. GENERATION OF SITE-BASED MUTANT CELL LINES BY CRISPR-CAS9 GENE EDITING Mutant ESC cell lines were generated by cloning gRNAs into a U6 vector (GE100042, Origene) and co-transfection with a Cas9-expressing vector (GE100018, Origene) using Fugene6 (E2691, Roche) as described in [4]. Guide sequences are listed in [S2 Table]. RNA-SEQ LIBRARY PREPARATION

Snippet: TGCCAGTCAGAAGAACGACC-3’ (for L444P) were inserted into the sgRNA cloning site of pCas-Guide-EF1a-GFP (Origene GE100018) per the manufacturer’s instructions. Corresponding ssDNA templates (synthesized at IDT) were used as homology donor templates to knock in the mutation of interest: for E326K the sequence 5’

Snippet: r Western blot and flow cytometry analyses. CRISPR-mediated deletion of CD38 CD38 was knocked out (CD38KO) in the Rab4A construct-transfected Jurkat cells using the pCas-Guide-EF1a-RFP CRISPR vector (Origene, catalog # GE100018;5’-ATCCTCGTCGTGGTGCTCGCGG-3’). The CRISPR vector was introduced into the Rab4A-transfected Jurkat cells using the Neon Transfection System (Invitrogen) following the m

Snippet: exons 3 (Clone#1) and 2 (Clone#2) of vdac2 were designed: ATTTGTTGAAGGTTTTGGGT and GATGGAGGAATACACATTGC, respectively. Each of the gRNAs was cloned into the pCas-Guide-EF1a-GFP (GE100018) vector from Origene. PLC cells were transfected with the indicated plasmids using Lipofectamine (Life Technologies, Carlsbad, CA, USA), 48 h after transfection single cells were sorted for GFP expression and co

Snippet: The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-GuideEF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville, MD). PC3 and LNCaP cells were transfected with the CRISPR plasmid using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific). Then, the cells were trypsinized and sorted via