OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SOX4 (NM_003107) Human Over-expression Lysate

Be the first to review this product
SKU
LC418894
Lyophilized SOX4 HEK293T cell transient overexpression lysate (as WB positive control)
Size:
20 ug 100 ug
Formulation:
Lyophilized Liquid
  $206.00
2 Weeks*
Bulk/Customize

Frequently Bought Together (3)

TA324704 SOX4 Antibody (N-term)
400 ul
$645.00
TA811000S beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control 30 ul
$200.00
TA592569 DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
100 ul
$519.00

Other products for "SOX4 or NM_003107"

Specifications
Specifications
Product Data
Species Human
Expression Host HEK293T
Expression cDNA Clone or AA Sequence TrueORF Clone RC209139
Tag C-Myc/DDK
Detection Antibodies Clone OTI4C5, Anti-DDK (FLAG) monoclonal antibody (TA50011-100)
ACCN NM_003107, NP_003098
Synonyms CSS10; EVI16
Predicted MW 47.3 kDa
Components 1 vial of 20 ug lyophilized total protein derived from gene specific transient over-expression cell lysate
Storage The lysate can be shipped at ambient temperature, however upon receipt of the sample store at -20°C. Lysate samples are stable for 12 months from the date of receipt when stored at -20°C in their original lyophilized form.  After reconstitution, avoid repeat freeze thaw cycles and store at -80°C. Lysate samples are stable for 12 months from date of receipt when stored at -20°C.
Shipping Blue Ice
Preparation HEK293T cells in 10-cm dishes were transiently transfected with MegaTran Transfection Reagent (TT200002) and 5ug TrueORF cDNA plasmid. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix (Sigma), 1mM PMSF and 1mM Na3VO4), and then centrifuged to clarify the lysate. Protein concentration was measured by BCA kit (Thermo Scientific Inc.). To facilitate transportation and protein, the products are supplied as lyophilized proteins.
Reconstitution Method The 20 µg lyophilized sample can be reconstituted with deionized water, or directly into 1x SDS-PAGE running buffer (with reducing agent) if the sample is being prepared directly to be run on a gel.  The lyophilized 20 ug product is derived from a liquid solution at 1 mg/ml of total lysate protein, thus reconstituting back to 1 mg/ml using 20 µl is recommended.  After reconstitution, avoid repeat freeze thaw cycles and store at -80°C.
Reference Data
RefSeq NP_003098
Locus ID 6659
Cytogenetics 6p22.3
Protein Families WB
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other "SOX4" proteins (3)
SKU Description Size Price
PH309139 SOX4 MS Standard C13 and N15-labeled recombinant protein (NP_003098) 10 ug
$3,360.00
LY418894 Transient overexpression lysate of SRY (sex determining region Y)-box 4 (SOX4) (as WB positive control) 100 ug
$436.00
TP309139 Recombinant protein of human SRY (sex determining region Y)-box 4 (SOX4), 20 µg 20 ug
$737.00

file-alt Citations

MicroRNA-338-3p targets SOX4 and inhibits cell proliferation and invasion of renal cell carcinoma
Tong, Meng, Wang et al
Exp Ther Med (2017) 14 (5), 5200-5206 DOI: 10.3892/etm.2017.5169
Cited by 25
AI Summary: OriGene’s SOX4 overexpression plasmid was used in this study to investigate the role of SOX4 in renal cell carcinoma cells and to assess how SOX4 overexpression could counteract the tumor-suppressive effects of miR-338-3p.
Snippet: A SOX4 overexpression plasmid was purchased from OriGene Technologies, Inc., (Beijing, China). miR-338-3p (100 nM), miR-NC (100 nM) or the SOX4 plasmid (100 ng) were transfected into RCC cells using Lipofectamine 2000 (Invitrogen;Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions
Down-regulated SOX4 expression suppresses cell proliferation, metastasis and induces apoptosis in Xuanwei female lung cancer patients
Zhou, Wang, Huang et al
J. Cell. Biochem. (2015)
Cited by 37
AI Summary: OriGene's pGFP-V-RS retroviral vector was used to deliver SOX4-targeting shRNA into lung cancer cells, enabling the authors to investigate the effects of SOX4 knockdown on cell proliferation, metastasis, and apoptosis.
Snippet: Cell transfection SOX4 small hairpin RNA (shRNA) was designed and cloned into the pGFP-V-RS retroviral vector (Origene, Maryland, USA). The pGFP-V-RS-SOX4 shRNA sequence was AGCAAACCGCACGCCAAGCTCATCCTGGC, and the negative control shRNA ... Related articles All 3 versions Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products