NLRC5 Human Gene Knockout Kit (CRISPR)

CAT#: KN414810

Reviews ()
Write a review

NLRC5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

KN2.0 knockout kit validation

  See Other Versions

KN414810 is the updated version of KN214810.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol NLRC5
Locus ID 84166
Kit Components

KN414810G1, NLRC5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TCTCGGACCTCTTCAACACC

KN414810G2, NLRC5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCAGCTCAACTTGATCACG

KN414810D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001330552, NM_032206
Synonyms CLR16.1; NOD4; NOD27
Summary This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]


Other Versions

Other products for "NLRC5"
Frequently bought together (2)
Rabbit Polyclonal NOD4 Antibody
    • 100 ug

USD 430.00

NLRC5 (Myc-DDK-tagged)-Human NLR family, CARD domain containing 5 (NLRC5)
    • 10 ug

USD 1,960.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools