Smad4 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN316273

Smad4 - mouse gene knockout kit via CRISPR, HDR mediated

change donor?

 HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol Smad4
Locus ID 17128
Kit Components

KN316273G1, Smad4 gRNA vector 1 in pCas-Guide vector, Target Sequence: AGTTTGATGTGTCATAGACA

KN316273G2, Smad4 gRNA vector 2 in pCas-Guide vector, Target Sequence: ACTATGTACAATGCTCAGAC

KN316273-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq BC046584, NM_008540, XM_006525701, XM_006525702, XM_011246855
Synonyms AW743858; D18Wsu70e; DPC4; Madh4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
