OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Neo1 Mouse Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN310902
Neo1 - mouse gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA341799 Rabbit Polyclonal Anti-Neo1 Antibody
100 ul
$585.00
MR226235 Neo1 (Myc-DDK-tagged) - Mouse neogenin (Neo1), transcript variant 1
10 ug
$589.00 $1,276.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Neo1 or BC054540"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol Neo1
Locus ID 18007
Components

KN310902G1, Neo1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGAGGTGCAGAGGAGTCGCC

KN310902G2, Neo1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGCGGACAGCAGCGCCGGG

KN310902D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001042752, NM_008684
Synonyms 2610028H22Rik; AI327052; D930014N22Rik; Igdcc2
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA202861 Neo1 CRISPRa kit - CRISPR gene activation of mouse neogenin 1 kit
$1,657.00
KN310902BN Neo1 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN310902LP Neo1 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN310902RB Neo1 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN510902 Neo1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products