Alox12 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN301155

Reviews ()
Write a review

Alox12 - mouse gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Alox12
Locus ID 11684
Kit Components

KN301155G1, Alox12 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TACCGCGTCCGTGTGGTCAC

KN301155G2, Alox12 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CCCTCAACCTAGTGCGTTTG

KN301155-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001331118, NM_007440
Synonyms 9930022G08Rik; Alox12p; P-12LO


Other Versions

Other products for "Alox12"
Frequently bought together (1)
Alox12 (Myc-DDK-tagged) - Mouse arachidonate 12-lipoxygenase (Alox12)
    • 10 ug

USD 610.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools