OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NF-kB p65 (RELA) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN220780
RELA - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA890002 Rabbit polyclonal RELA Antibody
100 ul
$407.00
RC220780 RELA (Myc-DDK-tagged)-Human v-rel reticuloendotheliosis viral oncogene homolog A (avian) (RELA), transcript variant 1
10 ug
$513.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "NF-kB p65 or NM_001145138"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol NF-kB p65
Locus ID 5970
Components

KN220780G1, NF-kB p65 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGCGGGGTGGCATCGCCG

KN220780G2, NF-kB p65 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGGCCGCCGCGGCTGTGGC

KN220780D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001145138, NM_001243984, NM_001243985, NM_021975
UniProt ID Q04206
Synonyms NFKB3; p65
Summary NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Sep 2011
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA104066 RELA CRISPRa kit - CRISPR gene activation of human RELA proto-oncogene, NF-kB subunit 1 kit
$1,657.00
KN220780BN RELA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN220780LP RELA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN220780RB RELA - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN420780 RELA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products