OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LIN28B Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN213537
LIN28B - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA324574 LIN28B Antibody (N-term)
400 ul
$645.00
RC213537 LIN28B (Myc-DDK-tagged)-Human lin-28 homolog B (C. elegans) (LIN28B)
10 ug
$450.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "LIN28B or NM_001004317"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol LIN28B
Locus ID 389421
Components

KN213537G1, LIN28B gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGTGGGGCAACATGGCCGA

KN213537G2, LIN28B gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAGAAAAGAAAATTAACCTT

KN213537D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001004317
UniProt ID Q6ZN17
Synonyms CSDD2
Summary The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. provided by RefSeq, Jun 2012
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA118054 LIN28B CRISPRa kit - CRISPR gene activation of human lin-28 homolog B 1 kit
$1,657.00
KN213537BN LIN28B - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN213537LP LIN28B - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN213537RB LIN28B - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN413537 LIN28B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products