SMURF2 Human Gene Knockout Kit (CRISPR)

CAT#: KN210866

SMURF2 - human gene knockout kit via CRISPR

change donor?

USD 1,290.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Symbol SMURF2
Locus ID 64750
Kit Components

KN210866G1, SMURF2 gRNA vector 1 in pCas-Guide vector, Target Sequence: CCCGTCAAGCTGCGCCTGAC

KN210866G2, SMURF2 gRNA vector 2 in pCas-Guide vector, Target Sequence: GGGCCCGTTCCTCCGGCCTC

KN210866-D, donor vector containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet

ACCCTCGGCGGCAGCTCACACCCTCCCTGACTGCCGGTGCCCGCCAGGGCACCCTGCGCGCGCCCGCCGGCCCCGCCCCGGCCCCGCCCCGCCCCGCCGGCCCCGCCTCCCGTCTCCTCCCCGCCCCCCGGAGCCGACGAGTGGCGGCGGCGGCCCCAGGTCCCGGGTCCCTCAGACAAGAGGGCGGGTGGAGGAGGAAGCGGCCGAGCCCAGAGTTCTGCTCCGGCGCCCCCGAGCACCGCCCGCTTCAGCCGACCAGCCCCGTCGGCTACTGGGCCTCGCCGAGACGAGAGGAGGGAAAGGCCTCGGCGGCCGCGAGGAGGCGGCGGGGGCGCGGGCGGAGGCGGCGCGGGCGGCCGCGGCTGCCGCTTTGTTGTGCGGCCCGGGCCGAGGAAGGAGAAGTGGGAGGAGGGGGGAGCTCGGCGTCCCGCTCCCTCCGCGGCTCATGGCGACGACTCTCGGCACATCCGGGACCCTCCGGCCGTGGCGGCCGAGGCGCCGGCTGCTCGGGCCCCAGCCCCGGCCGCTGTGGTGACTCCGCCGCGCCTCGCCGTCGCCCCCGTGCCGCCCGCCGCCCCCGCCGCCCCCGCCGCCGGGGAC GTGGGCGAGCTGGCGGGGGGTGCCTGTGGCCTTGGGAAGGGCCAGGGTCGCGATCAATGATGAGTTGGGGGTCGGAGGAATGGGAAGGCCTAGTTCAGGGAGAGTAATTGGAAAACCACTTGCTCTGGTTTGGACATTGTTTAAAAAGCCGAGGATGACTCGGGGCGGGGGGTGGTGTTTTGTGGAGGGGAGAATACACCGGTTCGCATCGCAGGCGGATTTCAGGTCGGAAAGTCTTGGTCAAGGAGCCAGACGCTGCCTCCCGGGGCTCGGGGAACAGCCCCTGGGCTACCGCCCAGGTGAGATCGTGAAGGGGATGAAGAGCTCCCGTGGCGAGGATTATTGAATCCGGTTGCTGACTGCGCGCAGTAAACACTCCTTAAAGATGGAGCGCTTAACGGGAGGGTGTGCGTGTGTGTTCCCGGGTTGTTACCTTGCACACACCCAGTTATGCCCGCATGAAAAACCTTTACTCCCCGCCGCCGGCCACCGCTGCCCGGGCCACACACCTTAAACTCATGTCTCTGAGGTGAGGAGACAGGTTGACTTTTCCGGTGTGCCTGTCTGATCCGACGGCTTGGGCTCATTGTACACTGTGTT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_022739, XM_005257585, XM_011525128, XM_171878, XR_001752593
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents