TMX1 Human Gene Knockout Kit (CRISPR)

CAT#: KN206187

TMX1 - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

 Cited in 1 publication.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol TMX1
Locus ID 81542
Kit Components

KN206187G1, TMX1 gRNA vector 1 in pCas-Guide CRISPR vector, 10 ug, Target Sequence: CTCCGCCGCCCGTGCGTCCA

KN206187G2, TMX1 gRNA vector 2 in pCas-Guide CRISPR vector, 10 ug, Target Sequence: GGGAACTGCAAGACTCCCGG

KN206187-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_030755
Summary May participate in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyze dithiol-disulfide exchange reactions. [UniProtKB/Swiss-Prot Function]

Citations (1)


Other products for "TMX1"
Frequently bought together (2)
TMX1 mouse monoclonal antibody, clone OTI3H5 (formerly 3H5)
    • 100 ul

USD 360.00

TMX1 (Myc-DDK-tagged)-Human thioredoxin-related transmembrane protein 1 (TMX1)
    • 10 ug

USD 410.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones