OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

FGFR4 Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN204230LP
FGFR4 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA324961 FGFR4 Antibody (N-term)
200 ul
$645.00
RC204230 FGFR4 (Myc-DDK-tagged)-Human fibroblast growth factor receptor 4 (FGFR4), transcript variant 1
10 ug
$1,101.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "FGFR4 or NM_001291980"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Vector Luciferase-Puro
Target Symbol FGFR4
Locus ID 2264
Components

KN204230G1, FGFR4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTAGGAAGCTGGCAATCTCT

KN204230G2, FGFR4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AATCTCACCTTGATTACAGG

KN204230LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001291980, NM_002011, NM_022963, NM_213647, NM_001354984
UniProt ID P22455
Synonyms CD334; JTK2; TKF
Summary The protein encoded by this gene is a tyrosine kinase and cell surface receptor for fibroblast growth factors. The encoded protein is involved in the regulation of several pathways, including cell proliferation, cell differentiation, cell migration, lipid metabolism, bile acid biosynthesis, vitamin D metabolism, glucose uptake, and phosphate homeostasis. This protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. provided by RefSeq, Aug 2017
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA101587 FGFR4 CRISPRa kit - CRISPR gene activation of human fibroblast growth factor receptor 4 1 kit
$1,657.00
KN204230 FGFR4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN204230BN FGFR4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN204230RB FGFR4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN404230 FGFR4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products