PTGES Human Gene Knockout Kit (CRISPR)

CAT#: KN202405

PTGES - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol PTGES
Locus ID 9536
Kit Components

KN202405G1, PTGES gRNA vector 1 in pCas-Guide vector, 3-5 ug, Target Sequence: GGTCATCAAGATGTACGTGG

KN202405G2, PTGES gRNA vector 2 in pCas-Guide vector, 3-5 ug, Target Sequence: GGGCCGGGCTGCTCATCACC

KN202405-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_004878, NM_198797, XM_011519210
Synonyms MGST-IV; MGST1-L1; MGST1L1; MPGES; mPGES-1; PGES; PIG12; PP102; PP1294; TP53I12
Summary The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
