TRIM21 Human Gene Knockout Kit (CRISPR)

CAT#: KN202088

TRIM21 - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol TRIM21
Locus ID 6737
Kit Components

KN202088G1, TRIM21 gRNA vector 1 in pCas-Guide vector, 3-5 ug, Target Sequence: AGCACGCTTGACAATGATGT

KN202088G2, TRIM21 gRNA vector 2 in pCas-Guide vector, 3-5 ug, Target Sequence: TGGCCACACTCGATGCTCAC

KN202088-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_003141
Synonyms RNF81; Ro/SSA; RO52; SSA; SSA1
Summary This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]


Other products for "TRIM21"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies