PML Human Gene Knockout Kit (CRISPR)

CAT#: KN200700

PML - human gene knockout kit via CRISPR, HDR mediated


 HDR-mediated knockout kit validation

USD 1,290.00


Availability*
4 Weeks

Size
    • 1 kit

Cited in 1 publication.

Product images

Specifications

Product Data
Symbol PML
Locus ID 5371
Kit Components

KN200700G1, PML gRNA vector 1 in pCas-Guide vector, 3-5 ug, Target Sequence: CTCGGAGATCGGGCGGGTGC

KN200700G2, PML gRNA vector 2 in pCas-Guide vector, 3-5 ug, Target Sequence: GGCCTTCAGAGGGGGTCTCG

KN200700-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet

CCAAAATTAGTTCCCAAACAGGCTTTTGCAAGAGCTATCTTTTCTGTTTCAAGTGTCCCCCGTACCCCACCACCTACAACCCTAAATCCCTGGTGAATTTCCACTGCTTTTGCAGGTCCCAGCTGTGGGCTCTCCTTTCCAGAATGTCTCCGTTTGCAGGCTTGCTCTTCCATTACATCTACGGCTCTTAGAAAGCAGGGGCTGCGTGTGGCTCATCTTTGTACGCCCAGCTCCCGGCAGGACGTGGCACGAAGCAGTGCCAGTGTGAACGGATGAATGGATCAAAGCCGGGAGCAGGGCTGCCCCCCTGCAGCTCTGCCCTACCTCTCCCGCTTTACCGTAAGTCAGCGGTAGGTCTGCAGCTCTCCGCCTCTACCTCCTCCCCGCTCTGGGCGTGTCTTTAAAACCCACAGTCGGCCTCTCTGCCCCCTAGAACCGCCCCCAGCTTCTGTCTCACTTCCTCTCCAGAGGCGGGCCCTGAGCCGGCACCTCCCCTTTCGGACAGCTCAAGGGACTCAGCCAACTGGCTCACGCCTCCCCTTCAGCTTCTCTTCACGCACTCCAAGATCTAAACCGAGAATCGAAACTAAGCTGGGGTCC TACAGAGGTACTATTGGGTTAGGGGATGATGGGGTTAAGCTTTGTTGGTTTGCTGTGGTGGGGAGAGGCGGGAAGAGAGGGTCTAACGGAGGATTTGGTCAAGTACCCTAGAGAGTGACACAAAGCGGGAAGTCCAGACACCAGGGTCCTGACCGTCTCGGGTGGGGCAGGGAAGGGAGGGTAGGATAGAGTAGAAAAGAGGACACGGAGGAGTTGGGGCGGCCTCGCTGGGCTGCGGTTTCTCCACTGAGCAGTTGGGCAAGGTGAGAAGGGTCAGTGGCCTCCGGGCCTGGGCCCTTCCGCCCACCCTCGAGCCCTGCCTCAACTTTGCCTCAGATGCAGGACTTCAGATTAGGGAGGATGGAGGTAGTACCCCTGTTGCGCTGGCCTGGAGCCAGGGGCATGTCCCAGGCACGGCAAAACTAAAACCAACTTCCCAGATCCGAGGTGAGAAACTGGCTCAGACTGAAGAGGTATCTTTGCCAAGGCCTCCCAGCTCATGTGGTTTCTGCTTAAGGAAGCCTCCCCAACGAACCCTTCTCTTGCCACACCTTTCCTGCCCACCTCCCACCTCCCCCGACAAAGGAACTACTTGGGTTT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_002675, NM_033238, NM_033239, NM_033240, NM_033242, NM_033244, NM_033245, NM_033246, NM_033247, NM_033249, NM_033250
Synonyms MYL, RNF71, PP8675, TRIM19;MYL; PP8675; RNF71; TRIM19; promyelocytic leukemia protein; promyelocytic leukemia, inducer of; tripartite motif protein TRIM19; promyelocytic leukemia
Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents