EIF2S1 Human Gene Knockout Kit (CRISPR)

CAT#: KN200368

EIF2S1 - human gene knockout kit via CRISPR

change donor?

 HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol EIF2S1
Locus ID 1965
Kit Components

KN200368G1, EIF2S1 gRNA vector 1 in pCas-Guide vector, Target Sequence: TAAAATCTACAACTTAGACC

KN200368G2, EIF2S1 gRNA vector 2 in pCas-Guide vector, Target Sequence: GTCAGATCCATTGCTGAAAT

KN200368-D, donor DNA containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_004094
Synonyms EIF-2; EIF-2A; EIF-2alpha; EIF2; EIF2A
Summary The translation initiation factor EIF2 catalyzes the first regulated step of protein synthesis initiation, promoting the binding of the initiator tRNA to 40S ribosomal subunits. Binding occurs as a ternary complex of methionyl-tRNA, EIF2, and GTP. EIF2 is composed of 3 nonidentical subunits, the 36-kD EIF2-alpha subunit (EIF2S1), the 38-kD EIF2-beta subunit (EIF2S2; MIM 603908), and the 52-kD EIF2-gamma subunit (EIF2S3; MIM 300161). The rate of formation of the ternary complex is modulated by the phosphorylation state of EIF2-alpha (Ernst et al., 1987 [PubMed 2948954]).[supplied by OMIM, Feb 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
