OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human BORIS (CTCFL) activation kit by CRISPRa

Be the first to review this product
SKU
GA115390
CTCFL CRISPRa kit - CRISPR gene activation of human CCCTC-binding factor like
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA341445 Rabbit Polyclonal Anti-CTCFL Antibody
100 ul
$585.00
RC216042 CTCFL (Myc-DDK-tagged)-Human CCCTC-binding factor (zinc finger protein)-like (CTCFL)
10 ug
$925.00

Other products for "CTCFL"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CTCFL
Locus ID 140690
Components

GA115390G1, BORIS gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCCTCCCCTAGGTGTCAC

GA115390G2, BORIS gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGAGGGGGGTGGTGGGTAA

GA115390G3, BORIS gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGGTAGGAGGGCCAAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001269040, NM_001269041, NM_001269042, NM_001269043, NM_001269044, NM_001269045, NM_001269046, NM_001269047, NM_001269048, NM_001269049, NM_001269050, NM_001269051, NM_001269052, NM_001269054, NM_001269055, NM_080618, NR_072975
UniProt ID Q8NI51
Synonyms BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
Summary CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jun 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN216042 CTCFL - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN216042BN CTCFL - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN216042LP CTCFL - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN216042RB CTCFL - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN416042 CTCFL - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products