OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human STX1B activation kit by CRISPRa

Be the first to review this product
SKU
GA114367
STX1B CRISPRa kit - CRISPR gene activation of human syntaxin 1B
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA328136 STX1B Antibody (N-term)
400 ul
$645.00
RC209124 STX1B (Myc-DDK-tagged)-Human syntaxin 1B (STX1B)
10 ug
$300.00

Other products for "STX1B"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol STX1B
Locus ID 112755
Components

GA114367G1, STX1B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGAATTCAGGGAATAACC

GA114367G2, STX1B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGACGGAATGAATTCA

GA114367G3, STX1B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGCCAAGCGGAGATGCTA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_052874
UniProt ID P61266
Synonyms GEFSP9; STX1B1; STX1B2
Summary The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. provided by RefSeq, Jan 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN409124 STX1B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products