OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human FOXP3 activation kit by CRISPRa

Be the first to review this product
SKU
GA109480
FOXP3 CRISPRa kit - CRISPR gene activation of human forkhead box P3
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA810544 FOXP3 mouse monoclonal antibody,clone OTI3D1 100 ul
$447.00
RC217580 FOXP3 (Myc-DDK-tagged)-Human forkhead box P3 (FOXP3), transcript variant 1
10 ug
$686.00

Other products for "FOXP3"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol FOXP3
Locus ID 50943
Components

GA109480G1, FOXP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAATCACAGGGCCAACCCG

GA109480G2, FOXP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATTTTCAGATGACTCGTAA

GA109480G3, FOXP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGTCTCATAATCAAGAAA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001114377, NM_014009
UniProt ID Q9BZS1
Synonyms AIID; DIETER; IPEX; JM2; PIDX; XPID
Summary The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene are the cause of immunodeficiency polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN217580 FOXP3 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217580BN FOXP3 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217580LP FOXP3 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217580RB FOXP3 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN417580 FOXP3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products