OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human MAP4K4 activation kit by CRISPRa

Be the first to review this product
SKU
GA106309
MAP4K4 CRISPRa kit - CRISPR gene activation of human mitogen-activated protein kinase kinase kinase kinase 4
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA314915 Rabbit polyclonal anti-MEKKK 4 antibody
100 ul
$380.00
RC215163 MAP4K4 (Myc-DDK-tagged)-Human mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), transcript variant 2
10 ug
$1,149.00

Other products for "MAP4K4"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MAP4K4
Locus ID 9448
Components

GA106309G1, MAP4K4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTGTGAGTGCGTTTCCGC

GA106309G2, MAP4K4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTGCCTGAGGAGGAA

GA106309G3, MAP4K4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCCTCCGCCTCCGCCTCC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001242559, NM_001242560, NM_004834, NM_145686, NM_145687
UniProt ID O95819
Synonyms FLH21957; HEL-S-31; HGK; MEKKK4; NIK
Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN415163 MAP4K4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products