OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human OTX2 activation kit by CRISPRa

Be the first to review this product
SKU
GA103345
OTX2 CRISPRa kit - CRISPR gene activation of human orthodenticle homeobox 2
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA809511 OTX2 mouse monoclonal antibody,clone OTI1A1 100 ul
$447.00
RC207479 OTX2 (Myc-DDK-tagged)-Human orthodenticle homeobox 2 (OTX2), transcript variant 1
10 ug
$450.00

Other products for "OTX2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol OTX2
Locus ID 5015
Components

GA103345G1, OTX2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACAATTAGTTCACATGCTC

GA103345G2, OTX2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATTGACACATCTAAGCCAG

GA103345G3, OTX2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGTCAAAAAGTTGCCAGAG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001270523, NM_001270524, NM_001270525, NM_021728, NM_172337, NR_073034, NR_073036
UniProt ID P32243
Synonyms CPHD6; MCOPS5
Summary This gene encodes a member of the bicoid subfamily of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and plays a role in brain, craniofacial, and sensory organ development. The encoded protein also influences the proliferation and differentiation of dopaminergic neuronal progenitor cells during mitosis. Mutations in this gene cause syndromic microphthalmia 5 (MCOPS5) and combined pituitary hormone deficiency 6 (CPHD6). This gene is also suspected of having an oncogenic role in medulloblastoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Pseudogenes of this gene are known to exist on chromosomes two and nine. provided by RefSeq, Jul 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN207479 OTX2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN207479BN OTX2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN207479LP OTX2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN207479RB OTX2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN407479 OTX2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

Overexpression of OTX2 in human neural cells links depression risk genes
Feng, Wigg, Barr
Transl Psychiatry (2025) 15 (1), 141 DOI: 10.1038/s41398-025-03320-8
Cited by 5
AI Summary: OriGene products contributed OTX2 CRISPRa plasmids (GA103345, including activation vectors GA103345G1, GA103345G2, and GA103345G3) that were used to increase OTX2 expression in human neural precursor cells, enabling the study of OTX2-regulated genes linked to depression risk.
Snippet: … CRISPR Activation (CRISPRa) of OTX2 CRISPRa plasmids for OTX2 are obtained from Origene (GA103345, Rockville, MD). We used three activation vectors (GA103345G1, GA103345G2, GA103345G3) with 3 different guides to target OTX2 as well as one scramble negative control. … CRISPR Activation (CRISPRa) of OTX2 CRISPRa plasmids for OTX2 are obtained from Origene (GA103345, Rockville, MD). We used three activation vectors (GA103345G1, GA103345G2, GA103345G3) with 3 different guides to target OTX2 as well as one scramble negative control. …
Figure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products