OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human MECP2 activation kit by CRISPRa

Be the first to review this product
SKU
GA102863
MECP2 CRISPRa kit - CRISPR gene activation of human methyl-CpG binding protein 2
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA812397 MECP2 mouse monoclonal antibody,clone OTI2F1 100 ul
$447.00
RC202382 MECP2 (Myc-DDK-tagged)-Human methyl CpG binding protein 2 (Rett syndrome) (MECP2), transcript variant 1
10 ug
$457.00

Other products for "MECP2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MECP2
Locus ID 4204
Components

GA102863G1, MECP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGGATTAATGGACCCTTG

GA102863G2, MECP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGGAAATCTCGCCAATTGA

GA102863G3, MECP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATCACAGCCAATGACGGGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001110792, NM_001316337, NM_004992, NM_001369391, NM_001369394, NM_001369392, NM_001369393
UniProt ID P51608
Synonyms AUTSX3; MRX16; MRX79; MRXS13; MRXSL; PPMX; RS; RTS; RTT
Summary DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Oct 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN202382 MECP2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN202382BN MECP2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN202382LP MECP2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN202382RB MECP2 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN402382 MECP2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products