OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Integrin beta 1 (ITGB1) activation kit by CRISPRa

Be the first to review this product
SKU
GA102477
ITGB1 CRISPRa kit - CRISPR gene activation of human integrin subunit beta 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA807138 ITGB1 mouse monoclonal antibody,clone OTI9B5 100 ul
$447.00
RC203818 ITGB1 (Myc-DDK-tagged)-Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) (ITGB1), transcript variant 1A
10 ug
$731.00

Other products for "ITGB1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol ITGB1
Locus ID 3688
Components

GA102477G1, Integrin beta 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACAAAGGAACCGGCTGCGC

GA102477G2, Integrin beta 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCGACCGGGACAAAGGAAC

GA102477G3, Integrin beta 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAAGTGCGACCGGGACAA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002211, NM_033666, NM_033667, NM_033668, NM_033669, NM_133376
UniProt ID P05556
Synonyms CD29; FNRB; GPIIA; MDF2; MSK12; VLA-BETA; VLAB
Summary Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN203818 ITGB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN203818BN ITGB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN203818LP ITGB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN203818RB ITGB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN403818 ITGB1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products