OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human DHLAG (CD74) activation kit by CRISPRa

Be the first to review this product
SKU
GA100693
CD74 CRISPRa kit - CRISPR gene activation of human CD74 molecule
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA507339 CD74 mouse monoclonal antibody, clone OTI1H3 (formerly 1H3) 100 ul
$447.00
RC212964 CD74 (Myc-DDK-tagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 1
10 ug
$450.00

Other products for "CD74"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CD74
Locus ID 972
Components

GA100693G1, DHLAG gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATGTCCACTCCCTAGAC

GA100693G2, DHLAG gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGATCCCATTGGCTGCCCA

GA100693G3, DHLAG gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGCCAGCACGATCCCAT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001025158, NM_001025159, NM_004355, NR_157074, NM_001364083, NM_001364084
UniProt ID P04233
Synonyms DHLAG; HLADG; Ia-GAMMA; II
Summary The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. provided by RefSeq, Aug 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN405824 CD74 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products