Human CD36 activation kit by CRISPRa

SKU GA100670

CD36 CRISPRa kit - CRISPR gene activation of human CD36 molecule

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: CD36
• Locus ID: 948
• Components:

  GA100670G1, CD36 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATAGTAAAGAGGAAGGCTC

  GA100670G2, CD36 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGAGCAACCATCTGTTAAC

  GA100670G3, CD36 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCTGACACCTGAGCCAAA

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000072, NM_001001547, NM_001001548, NM_001127443, NM_001127444, NM_001289908, NM_001289909, NM_001289911, NR_110501
• UniProt ID: P16671
• Synonyms: BDPLT10; CHDS7; FAT; GP3B; GP4; GPIV; PASIV; SCARB3
• Summary: The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]