OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human B7-1 (CD80) activation kit by CRISPRa

Be the first to review this product
SKU
GA100663
CD80 CRISPRa kit - CRISPR gene activation of human CD80 molecule
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA501576 CD80 mouse monoclonal antibody, clone OTI2E5 (formerly 2E5) 100 ul
$447.00
RC206540 CD80 (Myc-DDK-tagged)-Human CD80 molecule (CD80)
10 ug
$289.00 $450.00

Other products for "CD80"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CD80
Locus ID 941
Components

GA100663G1, B7-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACACCACGAGCACCAGG

GA100663G2, B7-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTAGTCCATGCACGG

GA100663G3, B7-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTCCATGCACGGTGGTGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_005191
UniProt ID P33681
Synonyms B7; B7-1; B7.1; BB1; CD28LG; CD28LG1; LAB7
Summary The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. provided by RefSeq, Aug 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN406540 CD80 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products